version
PlantPromoterDB promoter information of AK120215

Summary of Gene (AK120215)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0175800        NCBI 
Gene model AK120215  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 2: 4140543-4141742)

Genome position     
from initiation codon
009-083-C02         
009-184-H07         
009-199-D07         
AK058292            
J013040G12          
J065050N21          
J065077O07          
J065102G05          
J065197A04          
J075024L24          
J075038K01          
J075044L04          
J075063D23          
J075079P13          
J075084G03          
J075135G07          
J075148D17          
J075150F13          
J075157F06          
J090054A05          
J090085O04          
J100023C04          
J100023H23          
J100026A16          
J100035K13          
TSS from cDNA
TSS information
AK120215                         5'->3' (+)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK120215

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+4141506-37

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTTCCTCCTCCTCCTCCC+41414864141505-57-38
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGAGGGAC+41413394141346-204-197
 OsREG652TGAGGGAC PPDB MotifGGGACCC  PLACE Motif 
REGCAAGCCCAG+41414034141411-140-132
 OsREG496CAAGCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG428 AAGCCCAG PPDB MotifGCCCA  PLACE Motif 
REGTCGGCCCAGCC+41414134141423-130-120
 OsREG658TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG620  GGCCCAGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG603   GCCCAGCC PPDB MotifGCCCA  PLACE Motif 
REGAGCCCAGCCCAACC+41414254141438-118-105
 OsREG464AGCCCAGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG603 GCCCAGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG533  CCCAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG523   CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511    CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG458     AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG595      GCCCAACC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone+4141547J013040G12, AK058292, J065050N21, J065077O07, J090085O04

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.