version
PlantPromoterDB promoter information of AK120377

Summary of Gene (AK120377)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0180300        NCBI 
Gene model AK120377  
Description Lipoprotein, type 6 family protein.  
#
#

Overview

Focused view (chromosome 1: 4213145-4211946)

Genome position     
from initiation codon
J013071N06          
J023088F12          
J100027H24          
J100053K15          
J100082M15          
TSS from cDNA
TSS information
AK120377                         5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK120377

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-4212302-157

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTCGTGGG-42123564212363-211-218
 OsREG529TTCGTGGG PPDB MotifGCCCA  PLACE Motif 
REGCGCGTGGGGG-42124424212451-297-306
 OsREG530CGCGTGGG   PPDB MotifGCCCA  PLACE Motif 
 OsREG536  CGTGGGGG PPDB Motif  PLACE Motif 
REGGTGGGTCCCACCAC-42124534212466-308-321
 OsREG622GTGGGTCC       PPDB MotifGGGACCC  PLACE Motif 
 OsREG637 TGGGTCCC      PPDB MotifGGGACCC  PLACE Motif 
 OsREG648  GGGTCCCA     PPDB MotifGGGACCC  PLACE Motif 
 OsREG650   GGTCCCAC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG651    GTCCCACC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG527      CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGACACGTGGCG-42125674212576-422-431
 OsREG434ACACGTGG   PPDB MotifACGT  PLACE Motif 
 OsREG507 CACGTGGC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG448  ACGTGGCG PPDB MotifACGT  PLACE MotifACGTGKC 
REGGCTGGGCTGGGCCCACAC-42125794212596-434-451
 OsREG464GCTGGGCT           PPDB MotifGCCCA  PLACE Motif 
 OsREG512 CTGGGCTG          PPDB MotifGCCCA  PLACE Motif 
 OsREG523  TGGGCTGG         PPDB MotifGCCCA  PLACE Motif 
 OsREG533   GGGCTGGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG603    GGCTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG620     GCTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG579      CTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG640        GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG627         GGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG598          GCCCACAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.