version
PlantPromoterDB promoter information of AK120428

Summary of Gene (AK120428)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0128200        NCBI 
Gene model AK120428  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 8: 1604317-1605516)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK120428                         5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK120428

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+1605301-16

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCACGTCACC+16050441605054-273-263
 OsREG585GCCACGTC    PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG505  CACGTCAC  PPDB MotifACGT  PLACE MotifTGAC 
 OsREG447   ACGTCACC PPDB MotifACGT  PLACE MotifTGAC 
REGCACGCCACGTGTCC+16050711605084-246-233
 OsREG502CACGCCAC       PPDB Motif  PLACE Motif 
 OsREG448  CGCCACGT     PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG507   GCCACGTG    PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434    CCACGTGT   PPDB MotifACGT  PLACE Motif 
 OsREG509     CACGTGTC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG451      ACGTGTCC PPDB MotifACGT  PLACE MotifACGTGKC 
REGCGGACGGC+16050971605104-220-213
 OsREG562CGGACGGC PPDB Motif  PLACE Motif 
REGGGCCGTGG+16051241605131-193-186
 OsREG521GGCCGTGG PPDB Motif  PLACE Motif 
REGCCACTGACA+16051741605182-143-135
 OsREG522CCACTGAC  PPDB Motif  PLACE MotifTGAC 
 OsREG510 CACTGACA PPDB Motif  PLACE MotifTGAC 
REGGTGGGTCCCACCAC+16051841605197-133-120
 OsREG622GTGGGTCC       PPDB MotifGGGACCC  PLACE Motif 
 OsREG637 TGGGTCCC      PPDB MotifGGGACCC  PLACE Motif 
 OsREG648  GGGTCCCA     PPDB MotifGGGACCC  PLACE Motif 
 OsREG650   GGTCCCAC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG651    GTCCCACC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG527      CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGCGTGTGGGCCCGGG+16051991605212-118-105
 OsREG526CGTGTGGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG598 GTGTGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG627  TGTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG566    TGGGCCCG   PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG543     GGGCCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG539      GGCCCGGG PPDB Motif  PLACE Motif 
REGGGCCCCACAC+16052311605240-86-77
 OsREG631GGCCCCAC   PPDB Motif  PLACE Motif 
 OsREG611 GCCCCACA  PPDB Motif  PLACE Motif 
 OsREG535  CCCCACAC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.