version
PlantPromoterDB promoter information of AK120553

Summary of Gene (AK120553)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0205700        NCBI 
Gene model AK120553  
Description Similar to Xaa-Pro dipeptidase (EC 3.4.-.-).  
#
#

Overview

Focused view (chromosome 7: 5732970-5731771)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK120553                         5'->3' (-)
Promoter sequence








 
                    
Os07g0205800        
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK120553

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-5732035-65

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCCTC-57320115732018-41-48
Y PatchTCTCTCTCT-57320375732045-67-75
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCGGCCCAGTT-57320785732088-108-118
 OsREG618GCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG454  GGCCCAGT  PPDB MotifGCCCA  PLACE Motif 
 OsREG425   GCCCAGTT PPDB MotifGCCCA  PLACE Motif 
REGCCCGGGCCGGCCC-57321035732115-133-145
 OsREG539CCCGGGCC      PPDB Motif  PLACE Motif 
 OsREG544 CCGGGCCG     PPDB Motif  PLACE Motif 
 OsREG615   GGGCCGGCCC PPDB MotifGCCCA  PLACE Motif 
REGCTGGCCCAGT-57321205732129-150-159
 OsREG577CTGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG578 TGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG454  GGCCCAGT PPDB MotifGCCCA  PLACE Motif 
REGGTTTGGGCCCAAG-57321315732143-161-173
 OsREG593GTTTGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG639  TTGGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG581     GGCCCAAG PPDB MotifGCCCA  PLACE Motif 
REGCCCACGGG-57322125732219-242-249
 OsREG531CCCACGGG PPDB MotifGCCCA, ACGGGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.