version
PlantPromoterDB promoter information of AK120644

Summary of Gene (AK120644)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0797600        NCBI 
Gene model AK120644  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 2: 34839318-34840517)

Genome position     
from initiation codon
004-004-A08         
006-050-H07         
006-092-B02         
006-100-B08         
013-037-D09         
013-068-H02         
AK060857            
AK098882            
AK104474            
J013001F21          
J013074D07          
J013096H23          
J013098H07          
J013132L13          
J013134K05          
J013155B15          
J023002L17          
J023013B08          
J023087I01          
J033071O04          
J065161N23          
J075055G11          
J075106J02          
J080009D06          
J080009N22          
J080016L03          
J080023E17          
J080027A12          
J080036M24          
J080038N07          
J080041A04          
J080042K11          
J080050A04          
J080053G16          
J080063D03          
J080063F07          
J080067H13          
J080068F12          
J080072G17          
J080072I06          
J080072J24          
J080076G09          
J080085H10          
J080092I17          
J080092N20          
J080093G10          
J090074C23          
J090083O18          
J100046M05          
J100050N16          
J100054D07          
J100054O11          
J100055F04          
J100055H22          
J100063A05          
J100063I24          
J100067I12          
J100074A22          
J100078B22          
J100079B03          
TSS from cDNA
TSS information
AK120644                         5'->3' (+)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK120644

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+34840174-144

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTATAAAAG+3484013834840145-180-173
Y PatchTCTCCCCC+3484016634840173-152-145
Y PatchTCTCTCCCCC+3484018134840190-137-128
Y PatchTCTTCCCC+3484021534840222-103-96
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGGGCCCACCT+3483989934839909-419-409
 OsREG647GGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG476   GCCCACCT PPDB MotifGCCCA  PLACE Motif 
REGTCCGTCCG+3483994134839948-377-370
 OsREG561TCCGTCCG PPDB Motif  PLACE Motif 
REGATCCGACGG+3483996634839974-352-344
 OsREG483ATCCGACG  PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG546 TCCGACGG PPDB MotifCCGAC  PLACE MotifCGACG 
REGCTCCCCCA+3484000834840015-310-303
 OsREG574CTCCCCCA PPDB Motif  PLACE Motif 
REGCAAGCCCAG+3484002434840032-294-286
 OsREG496CAAGCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG428 AAGCCCAG PPDB MotifGCCCA  PLACE Motif 
REGCGTGTGGC+3484010734840114-211-204
 OsREG573CGTGTGGC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.