version
PlantPromoterDB promoter information of AK120732

Summary of Gene (AK120732)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0246100        NCBI 
Gene model AK120732  
Description Protein of unknown function DUF902, CREBbp domain containing protein.  
#
#

Overview

Focused view (chromosome 1: 8054768-8053569)

Genome position     
from initiation codon
J023003C08          
J033072I19          
TSS from cDNA
TSS information
AK120732                         5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK120732

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-8054578-810

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGCTGGGCCAG-80547238054733-955-965
 OsREG603GGCTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG620 GCTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG578  CTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG577   TGGGCCAG PPDB MotifGCCCA  PLACE Motif 
REGAGCCCAAAC-80547368054744-968-976
 OsREG457AGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG593 GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGCACGGCCCGTT-80547558054765-987-997
 OsREG504CACGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG446 ACGGCCCG   PPDB MotifACGGGC  PLACE Motif 
 OsREG424   GGCCCGTT PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
REGCAAGTGGGCCGGC-80547708054782-1002-1014
 OsREG498CAAGTGGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG478  AGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG564   GTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542    TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG615     GGGCCGGC PPDB MotifGCCCA  PLACE Motif 
REGTCTGGCCCATCCACTGAC-80548038054820-1035-1052
 OsREG638TCTGGCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG577 CTGGCCCA          PPDB MotifGCCCA  PLACE Motif 
 OsREG488  TGGCCCAT         PPDB MotifGCCCA  PLACE Motif 
 OsREG590   GGCCCATC        PPDB MotifGCCCA  PLACE Motif 
 OsREG608    GCCCATCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG534     CCCATCCA      PPDB MotifGCCCA  PLACE Motif 
 OsREG522          CCACTGAC PPDB Motif  PLACE MotifTGAC 
REGCCGAGCCG-80548368054843-1068-1075
 OsREG540CCGAGCCG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.