version
PlantPromoterDB promoter information of AK121021

Summary of Gene (AK121021)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0309000        NCBI 
Gene model AK121021  
Description Zinc finger, FYVE/PHD-type domain containing protein.  
#
#

Overview

Focused view (chromosome 6: 11803410-11802211)

Genome position     
from initiation codon
                    
Os06g0309101        
TSS from cDNA
TSS information
AK121021                         5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK121021

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-11802595-185

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCCC-1180256811802575-158-165
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAGGCCCAGACAGCCCAAC-1180266211802680-252-270
 OsREG430AAGGCCCA            PPDB MotifGCCCA  PLACE Motif 
 OsREG473 AGGCCCAG           PPDB MotifGCCCA  PLACE Motif 
 OsREG629  GGCCCAGA          PPDB MotifGCCCA  PLACE Motif 
 OsREG435         ACAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG511          CAGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG458           AGCCCAAC PPDB MotifGCCCA, CCAACGG  PLACE Motif 
REGTCTGGCCC-1180268711802694-277-284
 OsREG638TCTGGCCC PPDB MotifGCCCA  PLACE Motif 
REGACGTGGGCTTTT-1180273511802746-325-336
 OsREG449ACGTGGGC     PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG463 CGTGGGCT    PPDB MotifGCCCA  PLACE Motif 
 OsREG427  GTGGGCTT   PPDB MotifGCCCA  PLACE Motif 
 OsREG421   TGGGCTTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG419    GGGCTTTT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.