PlantPromoterDB promoter information of AK121056
Summary of Gene (AK121056)
|
Overview
|
Focused view (chromosome 7: 23317620-23316421)
|
Genome position
from initiation codon J023056G18 J065131K04 J065190L19 J065209B06 J065216P11 J075144F24 J075180A07 J075181F03 J090030G19 J090088F06 J100058G17 TSS from cDNA TSS information AK121056 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence |
|
|
|
Promoter Summary of AK121056
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone peak | G | clone | - | 23316746 | -126 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | GTTTGGGCCTTCTTGGGCCGA | - | 23316794 | 23316814 | -174 | -194 | |||
| OsREG593 | GTTTGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG625 | TTTGGGCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG471 | TTGGGCCT | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG430 | TGGGCCTT | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG581 | CTTGGGCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG563 | TTGGGCCG | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG658 | TGGGCCGA | PPDB Motif | GCCCA | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||