version
PlantPromoterDB promoter information of AK121223

Summary of Gene (AK121223)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0162500        NCBI 
Gene model AK121223  
Description Similar to 40S ribosomal protein S14.  
#
#

Overview

Focused view (chromosome 2: 3362974-3361775)

Genome position     
from initiation codon
AK058629            
TSS from cDNA
TSS information
AK121223                         5'->3' (-)
Promoter sequence

 
J075013E05          
J075025L20          
J075149F15          
J075154J18          
J075188L11          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK121223

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-3360716-92
TSS clone peakGclone-3360708-84

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCATATATAAAG-33607423360752-118-128
Y PatchCCTTCCCT-33607173360724-93-100
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCCATAT-33607483360755-124-131
 OsREG480GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGCCCCCGCG-33607633360770-139-146
 OsREG537CCCCCGCG PPDB Motif  PLACE Motif 
REGGGTCCCACTTG-33608143360824-190-200
 OsREG650GGTCCCAC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG498   CCCACTTG PPDB MotifGCCCA  PLACE Motif 
REGTTGGCCCAGCCCATAA-33608323360847-208-223
 OsREG660TTGGCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG578 TGGCCCAG        PPDB MotifGCCCA  PLACE Motif 
 OsREG620  GGCCCAGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG603   GCCCAGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG533    CCCAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG523     CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG491      CAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG465       AGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG605        GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGCCTGGGCCGTC-33608673360877-243-253
 OsREG550CCTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG445  TGGGCCGT  PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG584   GGGCCGTC PPDB MotifGCCCA  PLACE Motif 
REGCATGGGCT-33608803360887-256-263
 OsREG467CATGGGCT PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGTTGGCCCATCC-33608983360908-274-284
 OsREG660TTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG488 TGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590  GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG608   GCCCATCC PPDB MotifGCCCA  PLACE Motif 
REGACCGGCCCAATT-33609223360933-298-309
 OsREG440ACCGGCCC     PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563  CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492   GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG433    GCCCAATT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.