version
PlantPromoterDB promoter information of AK121348

Summary of Gene (AK121348)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0127700        NCBI 
Gene model AK121348  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 8: 1583282-1584481)

Genome position     
from initiation codon
012-086-F03         
015-086-E12         
AK059350            
AK099242            
J023121K11          
J033027J18          
J043013E04          
J065012F22          
J065046N17          
J065197B02          
J100018P04          
J100052C14          
J100083A12          
TSS from cDNA
TSS information
AK121348                         5'->3' (+)
Promoter sequence










 
011-024-D11         
AK058365            
AK068373            
J013149L10          
J075027H17          
J075060F10          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence









 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK121348

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+1584139-143
TSS clone peakAclone+1584193-89

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCCCCC+15841411584150-141-132
Y PatchTCCTCCTC+15841621584169-120-113
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACGCGACGC+15839291583938-353-344
 OsREG583GACGCGAC   PPDB Motif  PLACE Motif 
 OsREG556  CGCGACGC PPDB Motif  PLACE MotifCGACG 
REGGTGGTGGGGTTGGGCCCCACGCG+15839891584011-293-271
 OsREG527GTGGTGGG                PPDB MotifGCCCA  PLACE Motif 
 OsREG595       GGTTGGGC         PPDB MotifGCCCA  PLACE Motif 
 OsREG626        GTTGGGCC        PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG639         TTGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG647          TGGGCCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG641           GGGCCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG631            GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG572             GCCCCACG   PPDB Motif  PLACE Motif 
 OsREG530               CCCACGCG PPDB MotifGCCCA  PLACE Motif 
REGTAGGCCCAACA+15840351584045-247-237
 OsREG656TAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626  GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594   GCCCAACA PPDB MotifGCCCA  PLACE Motif 
REGTAATGGGCCTACTGGGCTTTCGGCCCATGT+15840491584078-233-204
 OsREG610TAATGGGC                       PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC                      PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT                     PPDB MotifGCCCA  PLACE Motif 
 OsREG656   TGGGCCTA                    PPDB MotifGCCCA  PLACE Motif 
 OsREG604         TACTGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG428           CTGGGCTT            PPDB MotifGCCCA  PLACE Motif 
 OsREG421            TGGGCTTT           PPDB MotifGCCCA  PLACE Motif 
 OsREG634                 TTTCGGCC      PPDB Motif  PLACE Motif 
 OsREG642                  TTCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG658                   TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490                    CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517                     GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG437                      GCCCATGT PPDB MotifGCCCA  PLACE Motif 
REGGGGGCCCAGCACGCGTGGG+15841181584136-164-146
 OsREG647GGGGCCCA            PPDB MotifGCCCA  PLACE Motif 
 OsREG579 GGGCCCAG           PPDB MotifGCCCA  PLACE Motif 
 OsREG620  GGCCCAGC          PPDB MotifGCCCA  PLACE Motif 
 OsREG443          ACGCGTGG  PPDB Motif  PLACE Motif 
 OsREG530           CGCGTGGG PPDB MotifGCCCA  PLACE Motif 
REGCTCCCCCA+15841441584151-138-131
 OsREG574CTCCCCCA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakTclone-1583951AK058365, AK068373, J013149L10, AK058365, J075027H17, J075060F10
TSS clone peakGclone-1583936AK058365, AK068373, J013149L10, AK058365, J075027H17, J075060F10

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCGCGTGGGGCCCAACCCCACCAC-15839891584011AK058365, AK068373, J013149L10, J075027H17, J075060F10
 OsREG530CGCGTGGG                PPDB MotifGCCCA  PLACE Motif 
 OsREG572  CGTGGGGC              PPDB Motif  PLACE Motif 
 OsREG631   GTGGGGCC             PPDB Motif  PLACE Motif 
 OsREG641    TGGGGCCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG647     GGGGCCCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG639      GGGCCCAA          PPDB MotifGCCCA  PLACE Motif 
 OsREG626       GGCCCAAC         PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG595        GCCCAACC        PPDB MotifGCCCA  PLACE Motif 
 OsREG527               CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGTGTTGGGCCTA-15840351584045AK058365, AK068373, J013149L10, J075027H17, J075060F10
 OsREG594TGTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG626 GTTGGGCC   PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG471  TTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG656   TGGGCCTA PPDB MotifGCCCA  PLACE Motif 
REGACATGGGCCGAAAGCCCAGTAGGCCCATTA-15840491584078AK058365, AK068373, J013149L10, J075027H17, J075060F10
 OsREG437ACATGGGC                       PPDB MotifGCCCA  PLACE Motif 
 OsREG517 CATGGGCC                      PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG490  ATGGGCCG                     PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA                    PPDB MotifGCCCA  PLACE Motif 
 OsREG642    GGGCCGAA                   PPDB MotifGCCCA  PLACE Motif 
 OsREG634     GGCCGAAA                  PPDB Motif  PLACE Motif 
 OsREG421          AAAGCCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG428           AAGCCCAG            PPDB MotifGCCCA  PLACE Motif 
 OsREG604             GCCCAGTA          PPDB MotifGCCCA  PLACE Motif 
 OsREG656                   TAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474                    AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431                     GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG610                      GCCCATTA PPDB MotifGCCCA  PLACE Motif 
REGCCCACGCGTGCTGGGCCCC-15841181584136AK058365, AK068373, J013149L10, J075027H17, J075060F10
 OsREG530CCCACGCG            PPDB MotifGCCCA  PLACE Motif 
 OsREG443 CCACGCGT           PPDB Motif  PLACE Motif 
 OsREG620         GCTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG579          CTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG647           TGGGCCCC PPDB MotifGCCCA  PLACE Motif 
REGTGGGGGAG-15841441584151AK058365, AK068373, J013149L10, J075027H17, J075060F10
 OsREG574TGGGGGAG PPDB Motif  PLACE Motif 
REGCGCGACGCG-15842141584222AK058365, AK068373, J013149L10, J075027H17, J075060F10
 OsREG556CGCGACGC  PPDB Motif  PLACE MotifCGACG 
 OsREG559 GCGACGCG PPDB Motif  PLACE MotifCGACG 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.