version
PlantPromoterDB promoter information of AK121422

Summary of Gene (AK121422)

Organism Oryza sativa  
Chromosome 11  
Locus Os11g0484300        NCBI 
Gene model AK121422  
Description Similar to Mcm2-prov protein.  
#
#

Overview

Focused view (chromosome 11: 18872496-18873695)

Genome position     
from initiation codon
011-094-A06         
J023068H02          
J023133N01          
J033084H21          
TSS from cDNA
TSS information
AK121422                         5'->3' (+)
Promoter sequence













 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK121422

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+18873414-82

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCCTCT+1887337418873382-122-114
Y PatchCCTCCTCCTCCTCCCCC+1887339118873407-105-89
Y PatchCTCCTCCCC+1887342218873430-74-66
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAACTGGGCCAGA+1887319718873208-299-288
 OsREG425AACTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG454 ACTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG578  CTGGGCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG577   TGGGCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG638    GGGCCAGA PPDB MotifGCCCA  PLACE Motif 
REGAAATGGGCCGGGCCGAGGCCCAAA+1887321618873239-280-257
 OsREG422AAATGGGC                 PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC                PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG               PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG              PPDB MotifGCCCA  PLACE Motif 
 OsREG538    GGGCCGGG             PPDB MotifGCCCA  PLACE Motif 
 OsREG614     GGCCGGGC            PPDB Motif  PLACE Motif 
 OsREG616      GCCGGGCC           PPDB Motif  PLACE Motif 
 OsREG544       CCGGGCCG          PPDB Motif  PLACE Motif 
 OsREG568        CGGGCCGA         PPDB MotifACGGGC  PLACE Motif 
 OsREG575         GGGCCGAG        PPDB MotifGCCCA  PLACE Motif 
 OsREG587              GAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG471               AGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG625                GGCCCAAA PPDB MotifGCCCA  PLACE Motif 
REGTTTTGGGCTTC+1887325518873265-241-231
 OsREG592TTTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG457 TTTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG426  TTGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG582   TGGGCTTC PPDB MotifGCCCA  PLACE Motif 
REGGCCCACCT+1887328418873291-212-205
 OsREG476GCCCACCT PPDB MotifGCCCA  PLACE Motif 
REGCCCCCGCG+1887336318873370-133-126
 OsREG537CCCCCGCG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.