version
PlantPromoterDB promoter information of AK121523

Summary of Gene (AK121523)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0100700        NCBI 
Gene model AK121523  
Description Similar to 40S ribosomal protein S5-1.  
#
#

Overview

Focused view (chromosome 1: 25221-26420)

Genome position     
from initiation codon
006-066-G10         
009-108-B10         
AK059844            
AK121362            
J023037D16          
J033028P14          
J033064M07          
J033123M01          
J065026O07          
J065082A05          
J075003I02          
J075170J15          
J090037P17          
J100040D18          
TSS from cDNA
TSS information
AK121523                         5'->3' (+)
Promoter sequence


















 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK121523

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+26143-78

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTATAAAGG+2610826115-113-106
Y PatchTCTCCCCC+2612726134-94-87
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCGTCCGAT+2601526024-206-197
 OsREG562GCCGTCCG   PPDB Motif  PLACE Motif 
 OsREG545 CCGTCCGA  PPDB Motif  PLACE Motif 
 OsREG484  CGTCCGAT PPDB Motif  PLACE Motif 
REGCGATGGGC+2602626033-195-188
 OsREG553CGATGGGC PPDB MotifGCCCA  PLACE Motif 
REGCCTGGGCCGGGCCCGGCCCAGCCCAACA+2606726094-154-127
 OsREG550CCTGGGCC                     PPDB MotifGCCCA  PLACE Motif 
 OsREG616     GCCGGGCCCGGC            PPDB Motif  PLACE Motif 
 OsREG543      CCGGGCCCGG             PPDB MotifGCCCA  PLACE Motif 
 OsREG614    GGCCGGGCCCGGCC           PPDB Motif  PLACE Motif 
 OsREG538   GGGCCGGGCCCGGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG542  TGGGCCGG  CCGGCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CTGGGCCG    CGGCCCAG        PPDB MotifGCCCA  PLACE Motif 
 OsREG620              GGCCCAGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG603               GCCCAGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG533                CCCAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG523                 CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511                  CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG458                   AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594                    GCCCAACA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.