version
PlantPromoterDB promoter information of AK121527

Summary of Gene (AK121527)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0151900        NCBI 
Gene model AK121527  
Description Similar to Small GTP-binding protein.  
#
#

Overview

Focused view (chromosome 3: 2839376-2838177)

Genome position     
from initiation codon
009-084-F09         
016-041-G06         
AB032761            
AK105389            
J075028M03          
J075031H15          
J075045L24          
J075055K14          
J075100O08          
J075112B20          
J075188D21          
TSS from cDNA
TSS information
AK121527                         5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK121527

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-2838554-178

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCCCCCCTC-28385812838594-205-218
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGGGGCCCACT-28386102838621-234-245
 OsREG631GTGGGGCC     PPDB Motif  PLACE Motif 
 OsREG641 TGGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG647  GGGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG478    GGCCCACT PPDB MotifGCCCA  PLACE Motif 
REGCACTGACA-28386352838642-259-266
 OsREG510CACTGACA PPDB Motif  PLACE MotifTGAC 
REGTAAGCCCAC-28386812838689-305-313
 OsREG655TAAGCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG427 AAGCCCAC PPDB MotifGCCCA  PLACE Motif 
REGGGCCCCACA-28387032838711-327-335
 OsREG631GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG611 GCCCCACA PPDB Motif  PLACE Motif 
REGAGCCCAAAT-28387192838727-343-351
 OsREG457AGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG493 GCCCAAAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.