version
PlantPromoterDB promoter information of AK121568

Summary of Gene (AK121568)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0551800        NCBI 
Gene model AK121568  
Description Similar to T-complex protein 1, alpha subunit (TCP-1-alpha) (CCT-alpha).  
#
#

Overview

Focused view (chromosome 4: 28035665-28036864)

Genome position     
from initiation codon
016-049-G12         
J013073O06          
J013111B11          
J013121H23          
J023012A17          
J023092M05          
J033026P14          
J033033C10          
J033033M10          
J033035C24          
J033052E19          
J033140K19          
J043026H07          
J065036F18          
J065067L12          
J065095G09          
J065115B08          
J065218E24          
J090002N13          
J090008B12          
J090016F24          
J090019H14          
J090020G20          
J090029L18          
J090057C23          
J090073H23          
J090081C16          
J090081E21          
J090084L14          
J090086M01          
J090089E16          
J100031P12          
J100090N23          
TSS from cDNA
TSS information
AK121568                         5'->3' (+)
Promoter sequence











 
AK068663            
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK121568

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+28036569-96

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGCGGGGGCGAGG+2803632928036341-336-324
 OsREG537CGCGGGGG      PPDB Motif  PLACE Motif 
 OsREG549     GGGCGAGG PPDB MotifGCCCA  PLACE Motif 
REGCGCGTGGG+2803637728036384-288-281
 OsREG530CGCGTGGG PPDB MotifGCCCA  PLACE Motif 
REGCCATGGGCGAGG+2803639728036408-268-257
 OsREG525CCATGGGC     PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG549    GGGCGAGG PPDB MotifGCCCA  PLACE Motif 
REGGTTTGGGCCGGT+2803647428036485-191-180
 OsREG593GTTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG563  TTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG440    GGGCCGGT PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
REGTAATGGGCTGGGCT+2803648728036500-178-165
 OsREG610TAATGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG432 AATGGGCT      PPDB MotifGCCCA  PLACE Motif 
 OsREG491  ATGGGCTG     PPDB MotifGCCCA  PLACE Motif 
 OsREG523   TGGGCTGG    PPDB MotifGCCCA  PLACE Motif 
 OsREG533    GGGCTGGG   PPDB MotifGCCCA  PLACE Motif 
 OsREG603     GGCTGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG464      GCTGGGCT PPDB MotifGCCCA  PLACE Motif 
REGCAAGGCCCATCA+2803650428036515-161-150
 OsREG497CAAGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG430 AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474  AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590   GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG607    GCCCATCA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.