version
PlantPromoterDB promoter information of AK121759

Summary of Gene (AK121759)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0508100        NCBI 
Gene model AK121759  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 4: 25783055-25784254)

Genome position     
from initiation codon
009-180-A02         
J023007G10          
J033089A17          
J065193E13          
J075025M02          
J075027J10          
J075030N03          
J075045I20          
J075065E04          
J075134M16          
J075140B10          
TSS from cDNA
TSS information
AK121759                         5'->3' (+)
Promoter sequence










 
AK071432            
J023092D01          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence






 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK121759

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+25783973-82

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCTATAAAAG+2578393925783948-116-107
Y PatchCCCCTCCC+2578400625784013-49-42
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGCCCGTT+2578372825783735-327-320
 OsREG424GGCCCGTT PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
REGATCTCGGCCCAAT+2578376125783773-294-282
 OsREG485ATCTCGGC      PPDB Motif  PLACE Motif 
 OsREG635 TCTCGGCC     PPDB Motif  PLACE Motif 
 OsREG575  CTCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG563    CGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG492     GGCCCAAT PPDB MotifGCCCA  PLACE Motif 
REGAACTGGGCCGAGTCATGGGCCGCA+2578380725783830-248-225
 OsREG425AACTGGGC                 PPDB MotifGCCCA  PLACE Motif 
 OsREG454 ACTGGGCC                PPDB MotifGCCCA  PLACE Motif 
 OsREG565  CTGGGCCG               PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA              PPDB MotifGCCCA  PLACE Motif 
 OsREG575    GGGCCGAG             PPDB MotifGCCCA  PLACE Motif 
 OsREG609            TCATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG517             CATGGGCC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG490              ATGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG618               TGGGCCGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG643                GGGCCGCA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone-25783486AK071432, AK071432

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAACGGGCC-2578372825783735AK071432
 OsREG424AACGGGCC PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
REGATTGGGCCGAGAT-2578376125783773AK071432
 OsREG492ATTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG563 TTGGGCCG     PPDB MotifGCCCA  PLACE Motif 
 OsREG658  TGGGCCGA    PPDB MotifGCCCA  PLACE Motif 
 OsREG575   GGGCCGAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG635    GGCCGAGA  PPDB Motif  PLACE Motif 
 OsREG485     GCCGAGAT PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.