version
PlantPromoterDB promoter information of AK121761

Summary of Gene (AK121761)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0331900        NCBI 
Gene model AK121761  
Description Protein of unknown function DUF846, eukaryotic family protein.  
#
#

Overview

Focused view (chromosome 1: 12990727-12991926)

Genome position     
from initiation codon
013-026-D04         
AK064784            
J013000B15          
J033090D07          
J033090D14          
J090001H22          
J090006L21          
TSS from cDNA
TSS information
AK121761                         5'->3' (+)
Promoter sequence













 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK121761

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+12991582-145
TSS clone peakAclone+12991674-53

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGTGGGGCCCACGTGGGTCCCA+1299130112991323-426-404
 OsREG535GTGTGGGG                PPDB Motif  PLACE Motif 
 OsREG611 TGTGGGGC               PPDB Motif  PLACE Motif 
 OsREG631  GTGGGGCC              PPDB Motif  PLACE Motif 
 OsREG641   TGGGGCCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG647    GGGGCCCA            PPDB MotifGCCCA  PLACE Motif 
 OsREG640     GGGCCCAC           PPDB MotifGCCCA  PLACE Motif 
 OsREG571      GGCCCACG          PPDB MotifGCCCA  PLACE Motif 
 OsREG449       GCCCACGT         PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG508        CCCACGTGGG      PPDB MotifACGT  PLACE Motif 
 OsREG622             GTGGGTCC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG637              TGGGTCCC  PPDB MotifGGGACCC  PLACE Motif 
 OsREG648               GGGTCCCA PPDB MotifGGGACCC  PLACE Motif 
REGGCCACGTCGGAT+1299133712991348-390-379
 OsREG585GCCACGTC     PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG483    CGTCGGAT PPDB MotifCCGAC  PLACE MotifCGACG 
REGTGGGGGATG+1299140112991409-326-318
 OsREG482TGGGGGAT  PPDB Motif  PLACE Motif 
 OsREG516 GGGGGATG PPDB Motif  PLACE Motif 
REGATATGGGCCTA+1299149512991505-232-222
 OsREG480ATATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG656   TGGGCCTA PPDB MotifGCCCA  PLACE Motif 
REGGTTTGGGCCAA+1299151612991526-211-201
 OsREG593GTTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG659  TTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG660   TGGGCCAA PPDB MotifGCCCA  PLACE Motif 
REGTGTTGGGCCAG+1299153012991540-197-187
 OsREG594TGTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG626 GTTGGGCC   PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG659  TTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG577   TGGGCCAG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.