version
PlantPromoterDB promoter information of AK121885

Summary of Gene (AK121885)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0587300        NCBI 
Gene model AK121885  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 23899411-23898212)

Genome position     
from initiation codon
AK069419            
TSS from cDNA
TSS information
AK121885                         5'->3' (-)
Promoter sequence







 
                    
Os06g0587500        
Os06g0588400        
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK121885

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-23898476-65
TSS clone peakGclone-23898465-54

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACTGACATGTGGGCCCCACA-2389864423898664-233-253
 OsREG510CACTGACA              PPDB Motif  PLACE MotifTGAC 
 OsREG627        TGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640         GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647          TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641           GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631            GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG611             GCCCCACA PPDB Motif  PLACE Motif 
REGTGTTGGGCCCACA-2389867623898688-265-277
 OsREG594TGTTGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG626 GTTGGGCC     PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG639  TTGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG627     GGCCCACA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.