version
PlantPromoterDB promoter information of AK121963

Summary of Gene (AK121963)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0146700        NCBI 
Gene model AK121963  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 2562773-2563972)

Genome position     
from initiation codon
AK105609            
AK119490            
J033108C09          
J075046P21          
J075063E02          
J090078G14          
TSS from cDNA
TSS information
AK121963                         5'->3' (+)
Promoter sequence













 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK121963

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+2563697-76
TSS clone peakGclone+2563706-67

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTTTGGGCCAC+25634742563484-299-289
 OsREG592TTTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG659  TTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG653   TGGGCCAC PPDB MotifGCCCA  PLACE Motif 
REGAGCCCATCA+25634982563506-275-267
 OsREG466AGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG607 GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGTTGGCCCACCAGGCCCGGCCCACCCG+25635272563552-246-221
 OsREG660TTGGCCCA                   PPDB MotifGCCCA  PLACE Motif 
 OsREG654 TGGCCCAC                  PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGCCCACC      GGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG599   GCCCACCA                PPDB MotifGCCCA  PLACE Motif 
 OsREG524        CCAGGCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG616           GGCCCGGC        PPDB Motif  PLACE Motif 
 OsREG614            GCCCGGCC       PPDB Motif  PLACE Motif 
 OsREG538             CCCGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG542              CCGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG564               CGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG600                 GCCCACCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG528                  CCCACCCG PPDB MotifGCCCA  PLACE Motif 
REGCAAGGCCCACA+25635682563578-205-195
 OsREG497CAAGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG430 AAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG472  AGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG627   GGCCCACA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.