version
PlantPromoterDB promoter information of AK121966

Summary of Gene (AK121966)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0703900        NCBI 
Gene model AK121966  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 29906768-29907967)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AK121966                         5'->3' (+)
Promoter sequence

 
AK120025            
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK121966

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+29908525-93
TSS clone peakGclone+29908580-38

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGAGTGGG+2990843329908440-185-178
 OsREG532GGAGTGGG PPDB MotifGCCCA  PLACE Motif 
REGTCAGCCCAGCCCAGCCCAGCCGAGAT+2990846429908489-154-129
 OsREG657TCAGCCCA                   PPDB MotifGCCCA  PLACE Motif 
 OsREG512 CAGCCCAGCCCAGCCCAG        PPDB MotifGCCCA  PLACE Motif 
 OsREG464  AGCCCAGCCCAGCCCAGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG603   GCCCAGCCCAGCCCAGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG533    CCCAGCCCAGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG523     CCAGCCCAGCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG485                  GCCGAGAT PPDB Motif  PLACE Motif 
REGAGCCCACCAAC+2990849829908508-120-110
 OsREG462AGCCCACC    PPDB MotifGCCCA  PLACE Motif 
 OsREG599 GCCCACCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG520   CCACCAAC PPDB MotifCCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone-29907634AK120025, AK120025

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCGGATCGG-2990770329907710AK120025
 OsREG541CGGATCGG PPDB Motif  PLACE Motif 
REGCACGTGTC-2990780229907809AK120025
 OsREG509CACGTGTC PPDB MotifACGT  PLACE MotifACGTGKC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.