version
PlantPromoterDB promoter information of AK121997

Summary of Gene (AK121997)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0916300        NCBI 
Gene model AK121997  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 41700879-41699680)

Genome position     
from initiation codon
011-018-B12         
AK063922            
AK103107            
AK121061            
J033118P14          
J065002N16          
J065079B04          
J065102J07          
J065128F16          
J065184D11          
J065186A07          
J075115C07          
J075147C04          
TSS from cDNA
TSS information
AK121997                         5'->3' (-)
Promoter sequence



 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK121997

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-41700715-836
TSS clone peakGclone-41700682-803

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCGTATAA-4170074541700752-866-873
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTATGGGCCAC-4170081741700826-938-947
 OsREG630TATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG488 ATGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG653  TGGGCCAC PPDB MotifGCCCA  PLACE Motif 
REGAATTGGGCT-4170083641700844-957-965
 OsREG433AATTGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG460 ATTGGGCT PPDB MotifGCCCA  PLACE Motif 
REGAAATGGGC-4170088341700890-1004-1011
 OsREG422AAATGGGC PPDB MotifGCCCA  PLACE Motif 
REGTACTGGGCCTT-4170089441700904-1015-1025
 OsREG604TACTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG454 ACTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG473  CTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG430   TGGGCCTT PPDB MotifGCCCA  PLACE Motif 
REGTGTGGGCTGT-4170093041700939-1051-1060
 OsREG461TGTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG435  TGGGCTGT PPDB MotifGCCCA  PLACE Motif 
REGCCCCCACGT-4170100641701014-1127-1135
 OsREG536CCCCCACG  PPDB Motif  PLACE Motif 
 OsREG450 CCCCACGT PPDB MotifACGT  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.