version
PlantPromoterDB promoter information of AK122020

Summary of Gene (AK122020)

Organism Oryza sativa  
Chromosome 11  
Locus Os11g0202000        NCBI 
Gene model AK122020  
Description NONE  
#
#

Overview

Focused view (chromosome 11: 5139957-5138758)

Genome position     
from initiation codon
012-005-B08         
AK063427            
J033111N03          
J065051L10          
J065091N11          
J090045K19          
TSS from cDNA
TSS information
AK122020                         5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AK122020

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-5139280-323

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTCCC-51392705139277-313-320
Y PatchCCTTCCTCC-51393115139319-354-362
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACGTCTC-51393435139350-386-393
 OsREG506CACGTCTC PPDB MotifACGT  PLACE Motif 
REGGAGACGTGGACACGTGTC-51393525139369-395-412
 OsREG506GAGACGTG           PPDB MotifACGT  PLACE Motif 
 OsREG451       GGACACGT    PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG509        GACACGTGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGGTATGGGCCTAGGCCCATCCA-51394085139428-451-471
 OsREG606GTATGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG656   TGGGCCTAGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCTAGGCCCAT    PPDB MotifGCCCA  PLACE Motif 
 OsREG590           GGCCCATC   PPDB MotifGCCCA  PLACE Motif 
 OsREG608            GCCCATCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG534             CCCATCCA PPDB MotifGCCCA  PLACE Motif 
REGCAGGCCCATGA-51394335139443-476-486
 OsREG513CAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517  GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG609   GCCCATGA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.