version
PlantPromoterDB promoter information of AY224478

Summary of Gene (AY224478)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0438800        NCBI 
Gene model AY224478  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 15412784-15413983)

Genome position     
from initiation codon
AK060412            
AK100065            
AK103195            
J013160O05          
J023030C05          
J033025O04          
J033121P15          
J043034I23          
J065022N01          
J065022N02          
J065023M01          
J065101G13          
J075058P13          
J075186K10          
J075199F17          
TSS from cDNA
TSS information
AY224478                         5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AY224478

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+15413930-804

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCCTCTCTCTCTCCTC+1541391715413933-817-801
Y PatchTCTCTCTCT+1541393715413945-797-789
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACCGGGCCCCACG+1541365215413664-1082-1070
 OsREG441ACCGGGCC      PPDB Motif  PLACE Motif 
 OsREG543 CCGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG567  CGGGCCCC    PPDB MotifACGGGC  PLACE Motif 
 OsREG641   GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631    GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG572     GCCCCACG PPDB Motif  PLACE Motif 
REGCCCACGCG+1541369615413703-1038-1031
 OsREG530CCCACGCG PPDB MotifGCCCA  PLACE Motif 
REGCGCGTGCGGTG+1541376815413778-966-956
 OsREG555CGCGTGCG    PPDB Motif  PLACE Motif 
 OsREG500   GTGCGGTG PPDB Motif  PLACE Motif 
REGGCCGGCCCGGGCCCACCC+1541379315413810-941-924
 OsREG615GCCGGCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG544  CGGCCCGG         PPDB Motif  PLACE Motif 
 OsREG539   GGCCCGGGCC      PPDB Motif  PLACE Motif 
 OsREG543      CCGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG566       CGGGCCCA    PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640        GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628         GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG600          GCCCACCC PPDB MotifGCCCA  PLACE Motif 
REGCCCGGCCCCACCTGTCAG+1541381315413830-921-904
 OsREG538CCCGGCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG631   GGCCCCAC        PPDB Motif  PLACE Motif 
 OsREG612    GCCCCACC       PPDB Motif  PLACE Motif 
 OsREG514      CCCACCTG     PPDB MotifGCCCA  PLACE Motif 
 OsREG436       CCACCTGT    PPDB Motif  PLACE Motif 
 OsREG501        CACCTGTC   PPDB Motif  PLACE Motif 
 OsREG551          CCTGTCAG PPDB Motif  PLACE MotifTGAC 
REGGTGGCCCAGG+1541383915413848-895-886
 OsREG653GTGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG578 TGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG550  GGCCCAGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.