version
PlantPromoterDB promoter information of AY344493

Summary of Gene (AY344493)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0733200        NCBI 
Gene model AY344493  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 32337482-32338681)

Genome position     
from initiation codon
AK066316            
J013066G03          
J090034J08          
TSS from cDNA
TSS information
AY344493                         5'->3' (+)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AY344493

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+32338331-151

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCGCTATATAG+3233829232338302-190-180
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCACACGTGGC+3233803632338047-446-435
 OsREG573GCCACACG     PPDB Motif  PLACE Motif 
 OsREG434   ACACGTGG  PPDB MotifACGT  PLACE Motif 
 OsREG507    CACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGCACGTCAC+3233809932338106-383-376
 OsREG505CACGTCAC PPDB MotifACGT  PLACE MotifTGAC 
REGCCCACCTG+3233818032338187-302-295
 OsREG514CCCACCTG PPDB MotifGCCCA  PLACE Motif 
REGGCGGCCCAAGCCC+3233819932338211-283-271
 OsREG618GCGGCCCA      PPDB MotifGCCCA  PLACE Motif 
 OsREG563 CGGCCCAA     PPDB MotifGCCCA  PLACE Motif 
 OsREG581  GGCCCAAG    PPDB MotifGCCCA  PLACE Motif 
 OsREG519     CCAAGCCC PPDB MotifGCCCA  PLACE Motif 
REGCGCGACGCGAC+3233822532338235-257-247
 OsREG556CGCGACGC    PPDB Motif  PLACE MotifCGACG 
 OsREG559 GCGACGCG   PPDB Motif  PLACE MotifCGACG 
 OsREG583   GACGCGAC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.