version
PlantPromoterDB promoter information of AY551916

Summary of Gene (AY551916)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0752800        NCBI 
Gene model AY551916  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 31803967-31802768)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AY551916                         5'->3' (-)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AY551916

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-31804723-306

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCCCC-3180470631804713-289-296
Y PatchTCCTCCTCCTCCTCCTCCTC-3180472431804743-307-326
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCTCGCCC-3180484931804856-432-439
 OsREG549CCTCGCCC PPDB MotifGCCCA  PLACE Motif 
REGGGGGCCCGGGCCGGC-3180486131804875-444-458
 OsREG567GGGGCCCG        PPDB MotifACGGGC  PLACE Motif 
 OsREG543 GGGCCCGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG539  GGCCCGGGCC    PPDB Motif  PLACE Motif 
 OsREG544     CCGGGCCG   PPDB Motif  PLACE Motif 
 OsREG615       GGGCCGGC PPDB MotifGCCCA  PLACE Motif 
REGCGCACGCGTCGC-3180488431804895-467-478
 OsREG555CGCACGCG     PPDB Motif  PLACE Motif 
 OsREG559    CGCGTCGC PPDB Motif  PLACE MotifCGACG 
REGTCGGCCCAGAAAAGCCCACGA-3180490831804928-491-511
 OsREG658TCGGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CGGCCCAG             PPDB MotifGCCCA  PLACE Motif 
 OsREG629  GGCCCAGA            PPDB MotifGCCCA  PLACE Motif 
 OsREG419         AAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG421          AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG427           AAGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG463            AGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG601             GCCCACGA PPDB MotifGCCCA  PLACE Motif 
REGGACGGCCCAAAA-3180493431804945-517-528
 OsREG584GACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG563  CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625   GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG592    GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGATGGCCCACCC-3180496531804975-548-558
 OsREG487ATGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG654 TGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG600   GCCCACCC PPDB MotifGCCCA  PLACE Motif 
REGAATTGGGC-3180498631804993-569-576
 OsREG433AATTGGGC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.