version
PlantPromoterDB promoter information of BT014680

Summary of Gene (BT014680)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0609600        NCBI 
Gene model BT014680  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 25153158-25151959)

Genome position     
from initiation codon
AK072533            
AK099872            
J023008M02          
J023127M12          
J065049L24          
J065094F05          
J065102K24          
J065122O22          
J065205O14          
J075081P21          
J075127F01          
J080002F24          
J080004D23          
J080010O15          
J080015G02          
J080020I16          
J080021A01          
J080023G21          
J080032G14          
J080033E05          
J080033F07          
J080044A14          
J080044D11          
J080044H21          
J080045O14          
J080048E18          
J080057F11          
J080061K16          
J080063A09          
J080064E02          
J080067O07          
J080070P18          
J080076N20          
J080077J22          
J080079C02          
J080097J16          
TSS from cDNA
TSS information
BT014680                         5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of BT014680

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-25152956-798

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTCTCT-2515299725153006-839-848
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCCACAC-2515310125153108-943-950
 OsREG535CCCCACAC PPDB Motif  PLACE Motif 
REGCCTGGGCCCCACCTG-2515311625153130-958-972
 OsREG550CCTGGGCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG579 CTGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG641   GGGCCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG631    GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG612     GCCCCACC   PPDB Motif  PLACE Motif 
 OsREG514       CCCACCTG PPDB MotifGCCCA  PLACE Motif 
REGCCCACCAC-2515315825153165-1000-1007
 OsREG527CCCACCAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.