version
PlantPromoterDB promoter information of J013001D18

Summary of Gene (J013001D18)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0797700        NCBI 
Gene model J013001D18  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 34090121-34091320)

Genome position     
from initiation codon
005-001-F11         
AK061648            
AK098876            
J033070I21          
J065124F13          
J065218D02          
J075060K03          
J090080A22          
J100032P18          
TSS from cDNA
TSS information
J013001D18                       5'->3' (+)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013001D18

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+34091018-103
TSS clone peakGclone+34091083-38

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTCTC+3409108434091092-37-29
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTCCCACC+3409084634090853-275-268
 OsREG651GTCCCACC PPDB MotifGGGACCC  PLACE Motif 
REGCGACCCGC+3409101034091017-111-104
 OsREG552CGACCCGC PPDB Motif  PLACE Motif 
REGGCCCACGCGGCCCAGCCCAACC+3409102034091041-101-80
 OsREG602GCCCACGC               PPDB MotifGCCCA  PLACE Motif 
 OsREG530 CCCACGCG              PPDB MotifGCCCA  PLACE Motif 
 OsREG618      GCGGCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG565       CGGCCCAG        PPDB MotifGCCCA  PLACE Motif 
 OsREG620        GGCCCAGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG603         GCCCAGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG533          CCCAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG523           CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511            CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG458             AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG595              GCCCAACC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.