version
PlantPromoterDB promoter information of J013001H17

Summary of Gene (J013001H17)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0578000        NCBI 
Gene model J013001H17  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 28860692-28861891)

Genome position     
from initiation codon
003-126-A10         
AK065040            
J013036A06          
J013038O20          
J033122K08          
TSS from cDNA
TSS information
J013001H17                       5'->3' (+)
Promoter sequence













 
016-028-C02         
AK064201            
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence













 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013001H17

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+28861638-54

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTCTCCTC+2886162728861637-65-55
Y PatchCTCTCCTCC+2886166028861668-32-24
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTCCCCCA+2886149628861503-196-189
 OsREG574CTCCCCCA PPDB Motif  PLACE Motif 
REGCCATGGGCCCGGCCCATGTAGGCCCACAA+2886153528861563-157-129
 OsREG525CCATGGGC                      PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG517 CATGGGCC GGCCCATG            PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG489  ATGGGCCC                    PPDB MotifGCCCA  PLACE Motif 
 OsREG566   TGGGCCCG                   PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG543    GGGCCCGG                  PPDB MotifGCCCA  PLACE Motif 
 OsREG616     GGCCCGGC                 PPDB Motif  PLACE Motif 
 OsREG614      GCCCGGCC                PPDB Motif  PLACE Motif 
 OsREG538       CCCGGCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG542        CCGGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG490         CGGCCCAT             PPDB MotifGCCCA  PLACE Motif 
 OsREG437           GCCCATGT           PPDB MotifGCCCA  PLACE Motif 
 OsREG656                  TAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG472                   AGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG627                    GGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG597                     GCCCACAA PPDB MotifGCCCA  PLACE Motif 
REGTGTGGGCCTG+2886156528861574-127-118
 OsREG627TGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG472 GTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG513  TGGGCCTG PPDB MotifGCCCA  PLACE Motif 
REGTATGGGCCAG+2886157928861588-113-104
 OsREG630TATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG488 ATGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG577  TGGGCCAG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone-28861421AK064201, AK064201, 016-028-C02

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTGGGGGAG-2886149628861503016-028-C02, AK064201
 OsREG574TGGGGGAG PPDB Motif  PLACE Motif 
REGTTGTGGGCCTACATGGGCCGGGCCCATGG-2886153528861563016-028-C02, AK064201
 OsREG597TTGTGGGC                      PPDB MotifGCCCA  PLACE Motif 
 OsREG627 TGTGGGCC                     PPDB MotifGCCCA  PLACE Motif 
 OsREG472  GTGGGCCT                    PPDB MotifGCCCA  PLACE Motif 
 OsREG656   TGGGCCTA                   PPDB MotifGCCCA  PLACE Motif 
 OsREG437          ACATGGGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG517           CATGGGCC GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG490            ATGGGCCG          PPDB MotifGCCCA  PLACE Motif 
 OsREG542             TGGGCCGG         PPDB MotifGCCCA  PLACE Motif 
 OsREG538              GGGCCGGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG614               GGCCGGGC       PPDB Motif  PLACE Motif 
 OsREG616                GCCGGGCC      PPDB Motif  PLACE Motif 
 OsREG543                 CCGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG566                  CGGGCCCA    PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG489                   GGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG525                     GCCCATGG PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGCAGGCCCACA-2886156528861574016-028-C02, AK064201
 OsREG513CAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG472 AGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG627  GGCCCACA PPDB MotifGCCCA  PLACE Motif 
REGCTGGCCCATA-2886157928861588016-028-C02, AK064201
 OsREG577CTGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG488 TGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG630  GGCCCATA PPDB MotifGCCCA  PLACE Motif 
REGTGTGGGCT-2886159828861605016-028-C02, AK064201
 OsREG461TGTGGGCT PPDB MotifGCCCA  PLACE Motif 
REGTGTGGGCCCATTT-2886160728861619016-028-C02, AK064201
 OsREG627TGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG489   GGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431    GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG422     GCCCATTT PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.