version
PlantPromoterDB promoter information of J013002G23

Summary of Gene (J013002G23)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0225300        NCBI 
Gene model J013002G23  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 6489981-6488782)

Genome position     
from initiation codon
AK108638            
AK109268            
TSS from cDNA
TSS information
J013002G23                       5'->3' (-)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013002G23

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-6487554-423
TSS clone peakGclone-6487216-85

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCCTCCTCCTC-64871676487179-36-48
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGCGTCGCCTCGCCC-64872786487292-147-161
 OsREG559CGCGTCGC        PPDB Motif  PLACE MotifCGACG 
 OsREG549       CCTCGCCC PPDB MotifGCCCA  PLACE Motif 
REGCCCCCGCG-64873286487335-197-204
 OsREG537CCCCCGCG PPDB Motif  PLACE Motif 
REGGGGCCCCACTCT-64873436487354-212-223
 OsREG641GGGCCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG631 GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG455    CCCACTCT PPDB Motif  PLACE Motif 
REGCGCGACGCGAC-64874826487492-351-361
 OsREG556CGCGACGC    PPDB Motif  PLACE MotifCGACG 
 OsREG559 GCGACGCG   PPDB Motif  PLACE MotifCGACG 
 OsREG583   GACGCGAC PPDB Motif  PLACE Motif 
REGAAGGCCCAAATAGGCCCACT-64877496487768-618-637
 OsREG430AAGGCCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA            PPDB MotifGCCCA  PLACE Motif 
 OsREG625  GGCCCAAA           PPDB MotifGCCCA  PLACE Motif 
 OsREG493   GCCCAAAT          PPDB MotifGCCCA  PLACE Motif 
 OsREG656          TAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG472           AGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG478            GGCCCACT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.