version
PlantPromoterDB promoter information of J013020E19

Summary of Gene (J013020E19)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0618500        NCBI 
Gene model J013020E19  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 26258161-26259360)

Genome position     
from initiation codon
011-006-G12         
011-016-C10         
011-019-D03         
AK067476            
AK067570            
J013107O15          
J013110L15          
J033023K05          
J033046J12          
J033055D06          
J033070P15          
J043027K15          
J065073F12          
J065123I15          
J075182F03          
TSS from cDNA
TSS information
J013020E19                       5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013020E19

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+26259073-88

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATTGGGCCAGGTTGGGCCAT+2625894726258966-214-195
 OsREG492ATTGGGCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG659 TTGGGCCA  TTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG577  TGGGCCAG           PPDB MotifGCCCA  PLACE Motif 
 OsREG595         GGTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG626          GTTGGGCC   PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG487            TGGGCCAT PPDB MotifGCCCA  PLACE Motif 
REGTAATGGGCCGA+2625897126258981-190-180
 OsREG610TAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG  PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA PPDB MotifGCCCA  PLACE Motif 
REGTGATGGGCCTT+2625898426258994-177-167
 OsREG607TGATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG430   TGGGCCTT PPDB MotifGCCCA  PLACE Motif 
REGGAGGCCCACTACGGCCCACCT+2625901126259031-150-130
 OsREG587GAGGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG472 AGGCCCAC             PPDB MotifGCCCA  PLACE Motif 
 OsREG478  GGCCCACT            PPDB MotifGCCCA  PLACE Motif 
 OsREG645         TACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445          ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG564           CGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628            GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG476             GCCCACCT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.