version
PlantPromoterDB promoter information of J013022B18

Summary of Gene (J013022B18)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0463400        NCBI 
Gene model J013022B18  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 22804175-22805374)

Genome position     
from initiation codon
AK100354            
J023083G23          
TSS from cDNA
TSS information
J013022B18                       5'->3' (+)
Promoter sequence












 
Os05g0463300        
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013022B18

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+22804870-305

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGTGGGCCCCACA+2280460922804622-566-553
 OsREG547CCGTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG571 CGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641    GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631     GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG611      GCCCCACA PPDB Motif  PLACE Motif 
REGGGCCCCACA+2280476222804770-413-405
 OsREG631GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG611 GCCCCACA PPDB Motif  PLACE Motif 
REGGTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCC+2280479122804828-384-347
 OsREG606GTATGGGC                               PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC                              PPDB MotifGCCCA  PLACE Motif 
 OsREG489  ATGGGCCC       ATGGGCCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG566   TGGGCCCG                            PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG653          GTGGCCCA                     PPDB MotifGCCCA  PLACE Motif 
 OsREG488           TGGCCCAT                    PPDB MotifGCCCA  PLACE Motif 
 OsREG525             GCCCATGGGC                PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG517            GGCCCATGGGCC               PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG639                   GGGCCCAA            PPDB MotifGCCCA  PLACE Motif 
 OsREG626                    GGCCCAAC           PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG595                     GCCCAACC          PPDB MotifGCCCA  PLACE Motif 
 OsREG440                          ACCGGCCC     PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
 OsREG544                            CGGCCCGG   PPDB Motif  PLACE Motif 
 OsREG616                             GGCCCGGC  PPDB Motif  PLACE Motif 
 OsREG614                              GCCCGGCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.