version
PlantPromoterDB promoter information of J013024G05

Summary of Gene (J013024G05)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0160200        NCBI 
Gene model J013024G05  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 3186941-3188140)

Genome position     
from initiation codon
AK064836            
AK071081            
AK100712            
AK104859            
J013000F21          
J013035E12          
J013041A17          
J013045D10          
J013045F04          
J013046F04          
J013047F10          
J013051E10          
J013059J07          
J013059O17          
J013060A20          
J013063J23          
J013066D19          
J013069O08          
J013088K24          
J013098G04          
J013100I15          
J013102E18          
J013102O09          
J013119M18          
J013123I19          
J013146H15          
J013149A14          
J023003A05          
J023013O19          
J023044M05          
J023048O03          
J023049L17          
J023060D22          
J023060F20          
J023069G09          
J023086E11          
J023091I09          
J023091M19          
J023101D06          
J023109B03          
J023113B14          
J023114B19          
J023115H16          
J023134F22          
J023139I06          
J023150C02          
J033033A14          
J033058O11          
J033060H13          
J033075P14          
J033084O05          
J033087G04          
J033092E18          
J033101G23          
J033112I05          
J033118E14          
J033118P04          
J033123C07          
J043003C01          
J043024B21          
J043030N04          
J043039J02          
J043039N08          
J075006N21          
J075008A16          
J075018J16          
J075023G04          
J075134F18          
J075181B05          
J090014O14          
J090020H22          
J090022G17          
J090023J24          
J090033H01          
J090038A03          
J090041O22          
J090049E10          
J090063E24          
J090080N12          
J100021G23          
J100028P06          
J100060L21          
J100077D16          
J100088I09          
TSS from cDNA
TSS information
J013024G05                       5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013024G05

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+3187198-743
TSS clone peakCclone+3187235-706

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTCT+31871563187163-785-778
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACGGCCCAGT+31869553186965-986-976
 OsREG504CACGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG565  CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG454   GGCCCAGT PPDB MotifGCCCA  PLACE Motif 
REGCATCCCCC+31869683186975-973-966
 OsREG516CATCCCCC PPDB Motif  PLACE Motif 
REGCCCACTCT+31869983187005-943-936
 OsREG455CCCACTCT PPDB Motif  PLACE Motif 
REGCACACACC+31870283187035-913-906
 OsREG499CACACACC PPDB Motif  PLACE Motif 
REGCCCACCACGCGTCC+31870433187056-898-885
 OsREG527CCCACCAC       PPDB MotifGCCCA  PLACE Motif 
 OsREG443    CCACGCGT   PPDB Motif  PLACE Motif 
 OsREG442      ACGCGTCC PPDB Motif  PLACE Motif 
REGGCCCAGATCCAACGGCT+31870863187102-855-839
 OsREG486GCCCAGAT          PPDB MotifGCCCA  PLACE Motif 
 OsREG481      ATCCAACG    PPDB MotifCCAACGG  PLACE Motif 
 OsREG548       TCCAACGG   PPDB MotifCCAACGG  PLACE Motif 
 OsREG518        CCAACGGC  PPDB MotifCCAACGG  PLACE Motif 
 OsREG469         CAACGGCT PPDB MotifCCAACGG  PLACE Motif 
REGCATCCCCCA+31871103187118-831-823
 OsREG516CATCCCCC  PPDB Motif  PLACE Motif 
 OsREG482 ATCCCCCA PPDB Motif  PLACE Motif 
REGGTGACGTGGACCGGACGCGTCC+31871323187153-809-788
 OsREG505GTGACGTG               PPDB MotifACGT  PLACE MotifTGAC 
 OsREG570    CGTGGACC           PPDB Motif  PLACE Motif 
 OsREG442            GGACGCGTCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.