version
PlantPromoterDB promoter information of J013033N17

Summary of Gene (J013033N17)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0502700        NCBI 
Gene model J013033N17  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 24919121-24917922)

Genome position     
from initiation codon
013-040-E06         
AK064774            
AK065126            
AK099206            
J013000A23          
J013001P06          
J013026E14          
J013039I20          
J013045N11          
J013070L14          
J013099D12          
J013104J15          
J013128N17          
J013159L20          
J013162M14          
J023001G09          
J023113H03          
J033068M20          
J065039M22          
J065057B12          
J065057C23          
J065069A05          
J065069O15          
J065080A01          
J065081F08          
J065104D14          
J065117F05          
J065156G03          
J065178C01          
J065178C02          
J065206D22          
J065212F12          
J075015K06          
J075062J08          
J075063O17          
J075072G05          
J075098H11          
J075098J11          
J075098P09          
J075133G18          
J075137G02          
J075169K02          
J080001A02          
J080001F13          
J080007M21          
J080009M17          
J080011J02          
J080012I10          
J080013I03          
J080013I16          
J080021K10          
J080023P13          
J080024C08          
J080025P11          
J080027B13          
J080032P16          
J080033G07          
J080041F17          
J080041N19          
J080042C20          
J080046J24          
J080047L14          
J080049O11          
J080051E15          
J080052F01          
J080054A08          
J080054K14          
J080057G21          
J080059L15          
J080063H12          
J080070M24          
J080071D24          
J080077C20          
J080077O19          
J080078E08          
J080078N12          
J080079H13          
J080081I08          
J080082A17          
J080087A09          
J080087F22          
J080088I08          
J080090F19          
J080091H16          
J080091N06          
J080092H08          
J080097H19          
J080302C09          
J080302G05          
J080302K14          
J080303L01          
J080304D07          
J080305G03          
J080306B12          
J080307G07          
J080315A14          
J080318H14          
J100029P15          
J100042C22          
J100063F24          
J100087P16          
J100088A12          
TSS from cDNA
TSS information
J013033N17                       5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013033N17

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-24918868-747

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCCCTATATAGCC-2491889324918905-772-784
Y PatchCCTCCTCCT-2491885624918864-735-743
Y PatchTCCTCCCT-2491886624918873-745-752
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCACGTCGGACGGGTGTGGGCCCCACGAA-2491891924918948-798-827
 OsREG585GCCACGTC                       PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG545      TCGGACGG                 PPDB Motif  PLACE Motif 
 OsREG598              GTGTGGGC         PPDB MotifGCCCA  PLACE Motif 
 OsREG627               TGTGGGCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG640                GTGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG647                 TGGGCCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG641                  GGGCCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG631                   GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG572                    GCCCCACG   PPDB Motif  PLACE Motif 
 OsREG529                      CCCACGAA PPDB MotifGCCCA  PLACE Motif 
REGCAAGGCCC-2491895624918963-835-842
 OsREG497CAAGGCCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.