version
PlantPromoterDB promoter information of J013035F03

Summary of Gene (J013035F03)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0546000        NCBI 
Gene model J013035F03  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 22284868-22286067)

Genome position     
from initiation codon
006-045-E12         
006-081-A01         
AF188065            
AK061800            
AK065871            
J013024C02          
J013044J20          
J023115K21          
J043034O05          
J065056O07          
J065141P10          
J075167I16          
J090017E04          
J090029C01          
J090047I01          
J090053M24          
J090078J07          
J090084D04          
J090091G24          
J100032J02          
TSS from cDNA
TSS information
J013035F03                       5'->3' (+)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013035F03

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+22285777-91
TSS clone peakAclone+22285783-85

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATGGCCCAGAT+2228554222285552-326-316
 OsREG487ATGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG578 TGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG629  GGCCCAGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG486   GCCCAGAT PPDB MotifGCCCA  PLACE Motif 
REGGGCCCCACC+2228556222285570-306-298
 OsREG631GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG612 GCCCCACC PPDB Motif  PLACE Motif 
REGCACGTGGC+2228563422285641-234-227
 OsREG507CACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGCTGACAGGTGGGCCCACCAC+2228568422285703-184-165
 OsREG551CTGACAGG             PPDB Motif  PLACE MotifTGAC 
 OsREG501  GACAGGTG           PPDB Motif  PLACE Motif 
 OsREG436   ACAGGTGG          PPDB Motif  PLACE Motif 
 OsREG514    CAGGTGGG         PPDB MotifGCCCA  PLACE Motif 
 OsREG476     AGGTGGGC        PPDB MotifGCCCA  PLACE Motif 
 OsREG640       GTGGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628      GGTGGGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG599           GCCCACCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG527            CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGGCCGTCCG+2228571022285717-158-151
 OsREG562GCCGTCCG PPDB Motif  PLACE Motif 
REGGGCCCGGCCCGGCCGGCCCACC+2228572122285742-147-126
 OsREG616GGCCCGGCCCGGC          PPDB Motif  PLACE Motif 
 OsREG614 GCCCGGCCCGGCC         PPDB Motif  PLACE Motif 
 OsREG538  CCCGGCCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG544    CGGCCCGG           PPDB Motif  PLACE Motif 
 OsREG615           GCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG542            CCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG564             CGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG628              GGCCCACC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.