version
PlantPromoterDB promoter information of J013037K22

Summary of Gene (J013037K22)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0242600        NCBI 
Gene model J013037K22  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 7974519-7975718)

Genome position     
from initiation codon
AK065752            
TSS from cDNA
TSS information
J013037K22                       5'->3' (+)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013037K22

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+7974912-607

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCATATAAACG+79748767974886-643-633
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTGGCCCAAAT+79746237974633-896-886
 OsREG660TTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG659 TGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625  GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG493   GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGCCCACTCT+79747107974717-809-802
 OsREG455CCCACTCT PPDB Motif  PLACE Motif 
REGCCTGGGCCGGA+79747747974784-745-735
 OsREG550CCTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542  TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG644   GGGCCGGA PPDB MotifGCCCA  PLACE Motif 
REGAGCCCATTTAAGCCCACA+79748047974821-715-698
 OsREG432AGCCCATT           PPDB MotifGCCCA  PLACE Motif 
 OsREG422 GCCCATTT          PPDB MotifGCCCA  PLACE Motif 
 OsREG655        TAAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG427         AAGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG461          AGCCCACA PPDB MotifGCCCA  PLACE Motif 
REGCCCAGCCCATAT+79748327974843-687-676
 OsREG533CCCAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG523 CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG491  CAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG465   AGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480    GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGGTTTGGGCCCAGCCCATAA+79748537974871-666-648
 OsREG593GTTTGGGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG639  TTGGGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG579    GGGCCCAG        PPDB MotifGCCCA  PLACE Motif 
 OsREG620     GGCCCAGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG603      GCCCAGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG533       CCCAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG523        CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG491         CAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG465          AGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG605           GCCCATAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.