version
PlantPromoterDB promoter information of J013039N12

Summary of Gene (J013039N12)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0554000        NCBI 
Gene model J013039N12  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 27790489-27791688)

Genome position     
from initiation codon
011-055-F12         
AK111661            
AK112044            
J013134D02          
J033044L16          
J033073P14          
J033084B18          
J090016L07          
J090016M23          
TSS from cDNA
TSS information
J013039N12                       5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013039N12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+27791408-81

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGCGGCCCATAT+2779112127791132-368-357
 OsREG643TGCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG618 GCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630   GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480    GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGCATGGGCCGCA+2779113527791145-354-344
 OsREG517CATGGGCC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG490 ATGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG618  TGGGCCGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG643   GGGCCGCA PPDB MotifGCCCA  PLACE Motif 
REGTGCGGGCCCACAC+2779117127791183-318-306
 OsREG632TGCGGGCC      PPDB Motif  PLACE Motif 
 OsREG619 GCGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG566  CGGGCCCA    PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640   GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG627    GGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG598     GCCCACAC PPDB MotifGCCCA  PLACE Motif 
REGAGATGGGCCGGGCCGTA+2779119527791211-294-278
 OsREG456AGATGGGC          PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG        PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG538    GGGCCGGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG614     GGCCGGGC     PPDB Motif  PLACE Motif 
 OsREG616      GCCGGGCC    PPDB Motif  PLACE Motif 
 OsREG544       CCGGGCCG   PPDB Motif  PLACE Motif 
 OsREG446        CGGGCCGT  PPDB MotifACGGGC  PLACE Motif 
 OsREG645         GGGCCGTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.