version
PlantPromoterDB promoter information of J013045I05

Summary of Gene (J013045I05)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0667100        NCBI 
Gene model J013045I05  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 27028037-27026838)

Genome position     
from initiation codon
012-045-B01         
AK065363            
AK065952            
J013129F20          
TSS from cDNA
TSS information
J013045I05                       5'->3' (-)
Promoter sequence













 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013045I05

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-27027639-602
TSS clone peakAclone-27027631-594

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCGCGTATA-2702766627027673-629-636
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACCCCCCACGT-2702769227027702-655-665
 OsREG438ACCCCCCA    PPDB Motif  PLACE Motif 
 OsREG536  CCCCCACG  PPDB Motif  PLACE Motif 
 OsREG450   CCCCACGT PPDB MotifACGT  PLACE Motif 
REGGTGACGTG-2702774127027748-704-711
 OsREG505GTGACGTG PPDB MotifACGT  PLACE MotifTGAC 
REGACGTCACC-2702775227027759-715-722
 OsREG447ACGTCACC PPDB MotifACGT  PLACE MotifTGAC 
REGCACTGACACGTGGGCCCCACACGCCACACACC-2702786627027897-829-860
 OsREG510CACTGACA                         PPDB Motif  PLACE MotifTGAC 
 OsREG509    GACACGTG                     PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434     ACACGTGG                    PPDB MotifACGT  PLACE Motif 
 OsREG508      CACGTGGG                   PPDB MotifACGT  PLACE Motif 
 OsREG449       ACGTGGGC                  PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG571        CGTGGGCC                 PPDB MotifGCCCA  PLACE Motif 
 OsREG640         GTGGGCCC                PPDB MotifGCCCA  PLACE Motif 
 OsREG647          TGGGCCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG641           GGGCCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG631            GGCCCCAC             PPDB Motif  PLACE Motif 
 OsREG611             GCCCCACA            PPDB Motif  PLACE Motif 
 OsREG535              CCCCACAC           PPDB Motif  PLACE Motif 
 OsREG526               CCCACACG          PPDB MotifGCCCA  PLACE Motif 
 OsREG502                   CACGCCAC      PPDB Motif  PLACE Motif 
 OsREG499                        CACACACC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.