version
PlantPromoterDB promoter information of J013045O05

Summary of Gene (J013045O05)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0574800        NCBI 
Gene model J013045O05  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 23903081-23904280)

Genome position     
from initiation codon
006-097-G09         
013-077-E02         
014-010-B04         
AK067721            
AK069140            
AK104900            
J013037J23          
J013056A21          
J013119N24          
J023036H19          
J023036K16          
J023067J23          
J023075H08          
J023084K13          
J023097O10          
J033093K22          
J033105L08          
J065219H05          
J075010N07          
J075130I08          
J090014E16          
J090025K17          
J090030L19          
J090035J05          
J090036B17          
J090037A15          
J090064C17          
J090069L18          
J090073N11          
J090077F23          
J090099F02          
J100029N06          
J100056I04          
J100061A13          
J100062B10          
J100062J17          
J100072F22          
J100072J22          
J100076C03          
X91808              
Z11931              
TSS from cDNA
TSS information
J013045O05                       5'->3' (+)
Promoter sequence















 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013045O05

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+23903982-99

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGCCGTTT+2390376423903771-317-310
 OsREG420GGCCGTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGGGTCCAGA+2390379823903805-283-276
 OsREG649GGTCCAGA PPDB Motif  PLACE Motif 
REGGGTCCACG+2390381323903820-268-261
 OsREG570GGTCCACG PPDB Motif  PLACE Motif 
REGCCAGCCCAGCCCAGCCCACGGGCCGTGG+2390384123903868-240-213
 OsREG523CCAGCCCAGCCCAGCCCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG512 CAGCCCAGCCCAG               PPDB MotifGCCCA  PLACE Motif 
 OsREG464  AGCCCAGCCCAGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG603   GCCCAGCCCAGCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG533    CCCAGCCCAGCCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG463            AGCCCACG         PPDB MotifGCCCA  PLACE Motif 
 OsREG547             GCCCACGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG531              CCCACGGG       PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG446                  CGGGCCGT   PPDB MotifACGGGC  PLACE Motif 
 OsREG504                   GGGCCGTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG521                    GGCCGTGG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.