version
PlantPromoterDB promoter information of J013049L02

Summary of Gene (J013049L02)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0423500        NCBI 
Gene model J013049L02  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 20771855-20770656)

Genome position     
from initiation codon
015-048-C11         
AK066000            
TSS from cDNA
TSS information
J013049L02                       5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013049L02

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-20770922-67

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACGCCAC-2077098220770989-127-134
 OsREG502CACGCCAC PPDB Motif  PLACE Motif 
REGAGGTGGGCCCCACCTGTC-2077104720771064-192-209
 OsREG476AGGTGGGC           PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG641    GGGCCCCA       PPDB MotifGCCCA  PLACE Motif 
 OsREG631     GGCCCCAC      PPDB Motif  PLACE Motif 
 OsREG612      GCCCCACC     PPDB Motif  PLACE Motif 
 OsREG514        CCCACCTG   PPDB MotifGCCCA  PLACE Motif 
 OsREG436         CCACCTGT  PPDB Motif  PLACE Motif 
 OsREG501          CACCTGTC PPDB Motif  PLACE Motif 
REGCACGTGGGCCCACCT-2077115220771166-297-311
 OsREG508CACGTGGG        PPDB MotifACGT  PLACE Motif 
 OsREG449 ACGTGGGC       PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG571  CGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628      GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG476       GCCCACCT PPDB MotifGCCCA  PLACE Motif 
REGTTTCGGCC-2077116920771176-314-321
 OsREG634TTTCGGCC PPDB Motif  PLACE Motif 
REGCGCCACGTC-2077121420771222-359-367
 OsREG448CGCCACGT  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG585 GCCACGTC PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.