version
PlantPromoterDB promoter information of J013051M12

Summary of Gene (J013051M12)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0861700        NCBI 
Gene model J013051M12  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 37233282-37232083)

Genome position     
from initiation codon
AK066129            
J013104N13          
J065052E12          
J065136A17          
J100053G01          
TSS from cDNA
TSS information
J013051M12                       5'->3' (-)
Promoter sequence










 
006-106-E03         
011-018-A09         
AK068434            
AK109388            
J013154L15          
J013170I23          
J023031D05          
J023082E07          
J023095M10          
J023127D14          
J023138M15          
J023138M16          
J033060B18          
J033060F13          
J033096J11          
J033122C07          
J053029A10          
J053062O16          
J053064J08          
J053086F22          
J065036C04          
J065072J23          
J065120D04          
J065161D04          
J065172H02          
J065207B01          
J075019H18          
J075082E16          
J075089A10          
J075099G02          
J075134M04          
J075144K19          
J075147F17          
J090004O14          
J090013A07          
J090047K14          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence










 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013051M12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-37232326-44

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTATAAAAA-3723235737232364-75-82
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAAGTGGGCCGGCCCACCT-3723240137232419-119-137
 OsREG498CAAGTGGG            PPDB MotifGCCCA  PLACE Motif 
 OsREG478  AGTGGGCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG615     GGGCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542    TGGGCCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG564   GTGGGCCGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628          GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG476           GCCCACCT PPDB MotifGCCCA  PLACE Motif 
REGCGATGGGCTTA-3723244037232450-158-168
 OsREG553CGATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG466 GATGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG429  ATGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG655   TGGGCTTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone+37232535AK068434, AK068434, J013154L15, J033122C07, J013170I23, J023095M10, J023138M15, J023138M16, J033060B18, J065036C04, J065207B01, J090004O14, J090013A07, J090047K14, J053064J08, J065120D04, J023082E07, J033060F13, J075019H18, J075082E16, J075089A10, J075134M04, J075144K19, J075147F17, J023031D05, J075099G02, AK109388, J053062O16, J023127D14, J053029A10, J053086F22, J065072J23, J065161D04, J065172H02, J033096J11
TSS clone peakGclone+37232542AK068434, AK068434, J013154L15, J033122C07, J013170I23, J023095M10, J023138M15, J023138M16, J033060B18, J065036C04, J065207B01, J090004O14, J090013A07, J090047K14, J053064J08, J065120D04, J023082E07, J033060F13, J075019H18, J075082E16, J075089A10, J075134M04, J075144K19, J075147F17, J023031D05, J075099G02, AK109388, J053062O16, J023127D14, J053029A10, J053086F22, J065072J23, J065161D04, J065172H02, J033096J11, AF358762

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAGGTGGGCCGGCCCACTTG+3723240137232419AF358762, AK068434, AK109388, J013154L15, J013170I23, J023031D05, J023082E07, J023095M10, J023127D14, J023138M15, J023138M16, J033060B18, J033060F13, J033096J11, J033122C07, J053029A10, J053062O16, J053064J08, J053086F22, J065036C04, J065072J23, J065120D04, J065161D04, J065172H02, J065207B01, J075019H18, J075082E16, J075089A10, J075099G02, J075134M04, J075144K19, J075147F17, J090004O14, J090013A07, J090047K14
 OsREG476AGGTGGGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG615    GGGCCGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG564  GTGGGCCGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG478         GGCCCACT   PPDB MotifGCCCA  PLACE Motif 
 OsREG498           CCCACTTG PPDB MotifGCCCA  PLACE Motif 
REGTAAGCCCATCG+3723244037232450AF358762, AK068434, AK109388, J013154L15, J013170I23, J023031D05, J023082E07, J023095M10, J023127D14, J023138M15, J023138M16, J033060B18, J033060F13, J033096J11, J033122C07, J053029A10, J053062O16, J053064J08, J053086F22, J065036C04, J065072J23, J065120D04, J065161D04, J065172H02, J065207B01, J075019H18, J075082E16, J075089A10, J075099G02, J075134M04, J075144K19, J075147F17, J090004O14, J090013A07, J090047K14
 OsREG655TAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG429 AAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG466  AGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG553   GCCCATCG PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.