version
PlantPromoterDB promoter information of J013057F12

Summary of Gene (J013057F12)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0152800        NCBI 
Gene model J013057F12  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 2825421-2826620)

Genome position     
from initiation codon
AK065458            
J013022G05          
J013023D18          
J013048J16          
J013055I03          
J023109A22          
J023148E09          
J033069G17          
J033092I18          
J033093C02          
J033141M17          
J043016M18          
J090016D12          
J090071B10          
J090098K07          
J100035K14          
TSS from cDNA
TSS information
J013057F12                       5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013057F12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+2826288-133

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTCCCCC+28262662826276-155-145
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGGTCCCA+28260962826104-325-317
 OsREG637TGGGTCCC  PPDB MotifGGGACCC  PLACE Motif 
 OsREG648 GGGTCCCA PPDB MotifGGGACCC  PLACE Motif 
REGTACTGGGCCCACGTGT+28261232826138-298-283
 OsREG604TACTGGGC         PPDB MotifGCCCA  PLACE Motif 
 OsREG454 ACTGGGCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG579  CTGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC     PPDB MotifGCCCA  PLACE Motif 
 OsREG571     GGCCCACG    PPDB MotifGCCCA  PLACE Motif 
 OsREG449      GCCCACGT   PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG508       CCCACGTG  PPDB MotifACGT  PLACE Motif 
 OsREG434        CCACGTGT PPDB MotifACGT  PLACE Motif 
REGGGTGGGCCCCACCTG+28261692826183-252-238
 OsREG628GGTGGGCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG641   GGGCCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG631    GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG612     GCCCCACC   PPDB Motif  PLACE Motif 
 OsREG514       CCCACCTG PPDB MotifGCCCA  PLACE Motif 
REGGCCCCCAC+28261972826204-224-217
 OsREG613GCCCCCAC PPDB Motif  PLACE Motif 
REGCCCCACGTGT+28262092826218-212-203
 OsREG450CCCCACGT   PPDB MotifACGT  PLACE Motif 
 OsREG508 CCCACGTG  PPDB MotifACGT  PLACE Motif 
 OsREG434  CCACGTGT PPDB MotifACGT  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.