version
PlantPromoterDB promoter information of J013058P06

Summary of Gene (J013058P06)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0516600        NCBI 
Gene model J013058P06  
Description NONE  
#
#

Overview

Focused view (chromosome 9: 20781880-20780681)

Genome position     
from initiation codon
012-066-G06         
AK070780            
AK072458            
AK103563            
AY054407            
J013093G04          
J013096B07          
J023007G05          
J023024N12          
J023036C22          
J023063J20          
J023068N13          
J023091A08          
J023099I01          
J023105J21          
J023121E21          
J023126C21          
J023133G11          
J023136K23          
J023138D20          
J033022N20          
J033065N15          
J033109L23          
J053042L13          
J053048F16          
J053073C08          
J065135E24          
J065210M08          
J075080H01          
J075082K02          
J075094J24          
J075106P21          
J075142H01          
J090007P14          
J100078A03          
J100085B02          
TSS from cDNA
TSS information
J013058P06                       5'->3' (-)
Promoter sequence














 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013058P06

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-20781057-177
TSS clone peakAclone-20780978-98

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTCTC-2078097020780977-90-97
Y PatchTTCTCCTCC-2078097920780987-99-107
Y PatchCCTTCCTCTCTCCTCTCCTCTT-2078100820781029-128-149
Y PatchTCTCTCTCTC-2078105820781067-178-187
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACCCCCCA-2078106820781075-188-195
 OsREG438ACCCCCCA PPDB Motif  PLACE Motif 
REGAGGTGGGCCCCACGGCCCG-2078111820781136-238-256
 OsREG476AGGTGGGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG641    GGGCCCCA        PPDB MotifGCCCA  PLACE Motif 
 OsREG631     GGCCCCAC       PPDB Motif  PLACE Motif 
 OsREG572      GCCCCACG      PPDB Motif  PLACE Motif 
 OsREG521         CCACGGCC   PPDB Motif  PLACE Motif 
 OsREG504          CACGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG446           ACGGCCCG PPDB MotifACGGGC  PLACE Motif 
REGCCCGGGCCCACCAGCCCAG-2078114020781158-260-278
 OsREG539CCCGGGCC            PPDB Motif  PLACE Motif 
 OsREG543 CCGGGCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG566  CGGGCCCA          PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640   GGGCCCAC         PPDB MotifGCCCA  PLACE Motif 
 OsREG628    GGCCCACC        PPDB MotifGCCCA  PLACE Motif 
 OsREG599     GCCCACCA       PPDB MotifGCCCA  PLACE Motif 
 OsREG523          CCAGCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG512           CAGCCCAG PPDB MotifGCCCA  PLACE Motif 
REGGGACGGCT-2078120220781209-322-329
 OsREG468GGACGGCT PPDB Motif  PLACE Motif 
REGCCCATCCA-2078122920781236-349-356
 OsREG534CCCATCCA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.