version
PlantPromoterDB promoter information of J013062C05

Summary of Gene (J013062C05)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0595800        NCBI 
Gene model J013062C05  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 24903412-24904611)

Genome position     
from initiation codon
011-069-G09         
AK066349            
J023087C08          
J065012E12          
J065054A10          
J075067P16          
TSS from cDNA
TSS information
J013062C05                       5'->3' (+)
Promoter sequence





 
003-103-G05         
AK108488            
J065136O05          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence





 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013062C05

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+24904258-154

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGCCGAGA+2490398024903987-432-425
 OsREG635GGCCGAGA PPDB Motif  PLACE Motif 
REGCTCGCGCGAC+2490402924904038-383-374
 OsREG558CTCGCGCG   PPDB MotifACGCGC  PLACE Motif 
 OsREG557  CGCGCGAC PPDB MotifACGCGC  PLACE Motif 
REGAATTGGGCCTC+2490413524904145-277-267
 OsREG433AATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG492 ATTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG471  TTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587   TGGGCCTC PPDB MotifGCCCA  PLACE Motif 
REGCGTGTGGCCCATCG+2490415524904168-257-244
 OsREG573CGTGTGGC       PPDB Motif  PLACE Motif 
 OsREG653   GTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG488    TGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590     GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG553      GCCCATCG PPDB MotifGCCCA  PLACE Motif 
REGGCGGCCCAACT+2490418324904193-229-219
 OsREG618GCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563 CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626  GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG479   GCCCAACT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone-24903994AK108488, 003-103-G05, J065136O05, AK108488

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxAGCTATAAAA-2490402124904030003-103-G05, AK108488, J065136O05
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGAGGCCCAATT-2490413524904145003-103-G05, AK108488, J065136O05
 OsREG587GAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492  GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG433   GCCCAATT PPDB MotifGCCCA  PLACE Motif 
REGCGATGGGCCACACG-2490415524904168003-103-G05, AK108488, J065136O05
 OsREG553CGATGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG488  ATGGGCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG653   TGGGCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG573      GCCACACG PPDB Motif  PLACE Motif 
REGAGTTGGGCCGC-2490418324904193003-103-G05, AK108488, J065136O05
 OsREG479AGTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG626 GTTGGGCC   PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG563  TTGGGCCG  PPDB MotifGCCCA  PLACE Motif 
 OsREG618   TGGGCCGC PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.