version
PlantPromoterDB promoter information of J013063I02

Summary of Gene (J013063I02)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0340500        NCBI 
Gene model J013063I02  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 12735553-12734354)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
J013063I02                       5'->3' (-)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013063I02

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-12732654-51
TSS clone peakGclone-12732653-50

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTGTATAAA-1273268112732688-78-85
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACGCGTCC-1273271312732720-110-117
 OsREG442ACGCGTCC PPDB Motif  PLACE Motif 
REGTGTGGGGCCCACGGGTCAGTGG-1273273712732758-134-155
 OsREG611TGTGGGGC               PPDB Motif  PLACE Motif 
 OsREG631 GTGGGGCC              PPDB Motif  PLACE Motif 
 OsREG641  TGGGGCCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG647   GGGGCCCA            PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC           PPDB MotifGCCCA  PLACE Motif 
 OsREG571     GGCCCACG          PPDB MotifGCCCA  PLACE Motif 
 OsREG547      GCCCACGG         PPDB MotifGCCCA  PLACE Motif 
 OsREG531       CCCACGGG        PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG522              GTCAGTGG PPDB Motif  PLACE MotifTGAC 
REGGGCCCCACGTGTCAGTG-1273281312732829-210-226
 OsREG631GGCCCCAC          PPDB Motif  PLACE Motif 
 OsREG572 GCCCCACG         PPDB Motif  PLACE Motif 
 OsREG450  CCCCACGT        PPDB MotifACGT  PLACE Motif 
 OsREG508   CCCACGTG       PPDB MotifACGT  PLACE Motif 
 OsREG434    CCACGTGT      PPDB MotifACGT  PLACE Motif 
 OsREG509     CACGTGTC     PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG510         TGTCAGTG PPDB Motif  PLACE MotifTGAC 
REGCCACTGACA-1273283412732842-231-239
 OsREG522CCACTGAC  PPDB Motif  PLACE MotifTGAC 
 OsREG510 CACTGACA PPDB Motif  PLACE MotifTGAC 
REGCACGTGGGCCAT-1273287112732882-268-279
 OsREG508CACGTGGG     PPDB MotifACGT  PLACE Motif 
 OsREG449 ACGTGGGC    PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG571  CGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG654   GTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG487    TGGGCCAT PPDB MotifGCCCA  PLACE Motif 
REGGGACACGT-1273289212732899-289-296
 OsREG451GGACACGT PPDB MotifACGT  PLACE MotifACGTGKC 
REGCGGGTGGG-1273291112732918-308-315
 OsREG528CGGGTGGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.