version
PlantPromoterDB promoter information of J013063P08

Summary of Gene (J013063P08)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0539400        NCBI 
Gene model J013063P08  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 26863325-26862126)

Genome position     
from initiation codon
AK068572            
J013110N24          
J013156K22          
J043038A08          
J090004K18          
J090085F03          
TSS from cDNA
TSS information
J013063P08                       5'->3' (-)
Promoter sequence




 
AK103672            
J033136A05          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013063P08

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-26862483-158

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGGGGGT-2686258126862588-256-263
 OsREG438TGGGGGGT PPDB Motif  PLACE Motif 
REGCCCCCGCG-2686260226862609-277-284
 OsREG537CCCCCGCG PPDB Motif  PLACE Motif 
REGCGCACGCG-2686264526862652-320-327
 OsREG555CGCACGCG PPDB Motif  PLACE Motif 
REGGGCCCGCA-2686265526862662-330-337
 OsREG632GGCCCGCA PPDB Motif  PLACE Motif 
REGGCGACGCG-2686270026862707-375-382
 OsREG559GCGACGCG PPDB Motif  PLACE MotifCGACG 
REGCGTTCCGT-2686271226862719-387-394
 OsREG444CGTTCCGT PPDB Motif  PLACE Motif 
REGCGCCACGTCACTCCACGCC-2686273626862754-411-429
 OsREG448CGCCACGT            PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG585 GCCACGTC           PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG505   CACGTCAC         PPDB MotifACGT  PLACE MotifTGAC 
 OsREG636           TCCACGCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.