version
PlantPromoterDB promoter information of J013072D17

Summary of Gene (J013072D17)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0574500        NCBI 
Gene model J013072D17  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 28707225-28706026)

Genome position     
from initiation codon
006-021-A08         
006-049-A11         
006-056-A04         
006-081-C04         
006-086-F03         
006-090-G03         
009-051-F06         
AB015287            
AB015972            
AK061714            
AK070754            
AK098889            
AK121699            
J013001L15          
J013038L16          
J023028M04          
J023031F01          
J023114L22          
J033058L12          
J033073D17          
J043004C18          
J043004H12          
J043031D08          
J043036G01          
J065144O04          
J065181O08          
J075156J10          
J075163F17          
J075176O20          
J080017K15          
J080049O10          
J080066B20          
J100032B01          
TSS from cDNA
TSS information
J013072D17                       5'->3' (-)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013072D17

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-28706319-94

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCAGCTATAAAAC-2870634328706354-118-129
Y PatchTTCCTCCCCC-2870627428706283-49-58
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATCCAACGGCC-2870642128706431-196-206
 OsREG481ATCCAACG    PPDB MotifCCAACGG  PLACE Motif 
 OsREG548 TCCAACGG   PPDB MotifCCAACGG  PLACE Motif 
 OsREG518  CCAACGGC  PPDB MotifCCAACGG  PLACE Motif 
 OsREG494   CAACGGCC PPDB MotifCCAACGG  PLACE Motif 
REGCCGATCCG-2870645228706459-227-234
 OsREG541CCGATCCG PPDB Motif  PLACE Motif 
REGCGCGTGCG-2870647228706479-247-254
 OsREG555CGCGTGCG PPDB Motif  PLACE Motif 
REGATCCGACGGCCGAAA-2870648428706498-259-273
 OsREG483ATCCGACG        PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG546 TCCGACGG       PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG634       GGCCGAAA PPDB Motif  PLACE Motif 
REGCCAACGGC-2870650828706515-283-290
 OsREG518CCAACGGC PPDB MotifCCAACGG  PLACE Motif 
REGATCTCGGCCCATTAGGCCCATAT-2870652528706547-300-322
 OsREG485ATCTCGGC                PPDB Motif  PLACE Motif 
 OsREG635 TCTCGGCC               PPDB Motif  PLACE Motif 
 OsREG575  CTCGGCCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TCGGCCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG490    CGGCCCAT            PPDB MotifGCCCA  PLACE Motif 
 OsREG431     GGCCCATT           PPDB MotifGCCCA  PLACE Motif 
 OsREG610      GCCCATTA          PPDB MotifGCCCA  PLACE Motif 
 OsREG656            TAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474             AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630              GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480               GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGGGCCGAAA-2870656428706571-339-346
 OsREG634GGCCGAAA PPDB Motif  PLACE Motif 
REGATTGGGCTGT-2870660428706613-379-388
 OsREG460ATTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG511 TTGGGCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG435  TGGGCTGT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.