version
PlantPromoterDB promoter information of J013072F18

Summary of Gene (J013072F18)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0353400        NCBI 
Gene model J013072F18  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 13334540-13335739)

Genome position     
from initiation codon
006-092-E01         
006-120-A08         
009-098-A01         
009-139-G01         
013-041-E01         
013-068-C06         
014-014-G01         
014-088-E11         
AB110172            
AK062176            
AK068753            
AY656247            
J013049N20          
J013089L05          
J013099L20          
J013131G13          
J013157B15          
J013158E09          
J023013I18          
J023019G19          
J023027C18          
J023052J24          
J023080N08          
J033043F21          
J033044C08          
J033086N04          
J065041E07          
J065067N17          
J065082H19          
J065104D20          
J065105P09          
J065114D01          
J065119D15          
J065134G02          
J065143D06          
J065170G14          
J065178K06          
J065208P11          
J075004A10          
J075034E12          
J075035P22          
J075065O16          
J075070M03          
J075115B03          
J075190B04          
J080002C13          
J080010I08          
J080017L24          
J080023D11          
J080025A02          
J080025N09          
J080035D22          
J080038L13          
J080042F06          
J080043H05          
J080048K17          
J080053M20          
J080056I23          
J080057J06          
J080058C18          
J080062I15          
J080080E19          
J080096K12          
J090004M12          
J090055H05          
J090062J17          
J100044K10          
J100047I15          
J100047K03          
J100058I20          
J100067P14          
J100074F02          
TSS from cDNA
TSS information
J013072F18                       5'->3' (+)
Promoter sequence



 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013072F18

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+13335191-349
TSS clone peakAclone+13335222-318

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCTATAAATC+1333518813335197-352-343
Y PatchCTTCCTCTC+1333514513335153-395-387
Y PatchTCTCTCCCCC+1333525813335267-282-273
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGATCCG+1333506713335074-473-466
 OsREG541CCGATCCG PPDB Motif  PLACE Motif 
REGGCCGGCCCGGC+1333512413335134-416-406
 OsREG615GCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG544  CGGCCCGG  PPDB Motif  PLACE Motif 
 OsREG616   GGCCCGGC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.