version
PlantPromoterDB promoter information of J013075M04

Summary of Gene (J013075M04)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0557500        NCBI 
Gene model J013075M04  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 22906909-22908108)

Genome position     
from initiation codon
AK101830            
J033068I24          
TSS from cDNA
TSS information
J013075M04                       5'->3' (+)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013075M04

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+22907815-94

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCTCTCTCTCTCT+2290776922907783-140-126
Y PatchCTCTCCCCC+2290782822907836-81-73
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGTCCGATC+2290751922907527-390-382
 OsREG484CGTCCGAT  PPDB Motif  PLACE Motif 
 OsREG589 GTCCGATC PPDB Motif  PLACE Motif 
REGGATCGGACGG+2290754422907553-365-356
 OsREG589GATCGGAC   PPDB Motif  PLACE Motif 
 OsREG484 ATCGGACG  PPDB Motif  PLACE Motif 
 OsREG545  TCGGACGG PPDB Motif  PLACE Motif 
REGATCCGACG+2290768922907696-220-213
 OsREG483ATCCGACG PPDB MotifCCGAC  PLACE MotifCGACG 
REGAGAGTGGGCCCCACGT+2290772522907740-184-169
 OsREG455AGAGTGGG         PPDB Motif  PLACE Motif 
 OsREG478  AGTGGGCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG647    TGGGCCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG641     GGGCCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG631      GGCCCCAC   PPDB Motif  PLACE Motif 
 OsREG572       GCCCCACG  PPDB Motif  PLACE Motif 
 OsREG450        CCCCACGT PPDB MotifACGT  PLACE Motif 
REGCACGTCACC+2290776222907770-147-139
 OsREG505CACGTCAC  PPDB MotifACGT  PLACE MotifTGAC 
 OsREG447 ACGTCACC PPDB MotifACGT  PLACE MotifTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.