version
PlantPromoterDB promoter information of J013089M01

Summary of Gene (J013089M01)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0155100        NCBI 
Gene model J013089M01  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 3168313-3169512)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
J013089M01                       5'->3' (+)
Promoter sequence

 
004-001-C12         
014-030-C11         
AK060859            
AK099613            
J013050A14          
J013154C17          
J033039F14          
J033126I18          
J043005A17          
J053027C13          
J053033I07          
J053054P04          
J053060F22          
J053061P10          
J053065L13          
J053099H19          
J053101D09          
J075062C16          
J075129P09          
J075135C02          
J075147P13          
J090007K03          
J090050M06          
J090057M20          
J090070B06          
J090080D11          
J100021D15          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013089M01

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+3170598-265

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCACCTG+31703383170345-525-518
 OsREG514CCCACCTG PPDB MotifGCCCA  PLACE Motif 
REGCGGGTGGGGCC+31703703170380-493-483
 OsREG528CGGGTGGG    PPDB MotifGCCCA  PLACE Motif 
 OsREG612  GGTGGGGC  PPDB Motif  PLACE Motif 
 OsREG631   GTGGGGCC PPDB Motif  PLACE Motif 
REGGCCCATTA+31703913170398-472-465
 OsREG610GCCCATTA PPDB MotifGCCCA  PLACE Motif 
REGCGCCACGTCACGCCTCGCCC+31704023170421-461-442
 OsREG448CGCCACGT             PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG585 GCCACGTC            PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG505   CACGTCAC          PPDB MotifACGT  PLACE MotifTGAC 
 OsREG503        CACGCCTC     PPDB Motif  PLACE Motif 
 OsREG549            CCTCGCCC PPDB MotifGCCCA  PLACE Motif 
REGGGGTCCCA+31705083170515-355-348
 OsREG648GGGTCCCA PPDB MotifGGGACCC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.