version
PlantPromoterDB promoter information of J013092F14

Summary of Gene (J013092F14)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0512900        NCBI 
Gene model J013092F14  
Description NONE  
#
#

Overview

Focused view (chromosome 9: 20608603-20609802)

Genome position     
from initiation codon
006-033-F08         
006-054-F01         
006-066-A10         
006-088-A12         
AK061814            
AK066925            
AK104595            
J013151P03          
J023020A04          
J023055H19          
J023148N20          
J033131F06          
J053025L20          
J053054L04          
J053054P12          
J075003B20          
J075019N18          
J075032D10          
J075037G14          
J075056D05          
J075098D24          
J075106M13          
J075122N14          
J075146E22          
J075187E06          
J075198I17          
J080013K19          
J080034K06          
J080035K07          
J080039O16          
J080047G23          
J080050K22          
J080056B22          
J080083O07          
J090023O05          
J090084O14          
J100036A08          
J100040E10          
J100080P12          
J100082D15          
J100088B06          
TSS from cDNA
TSS information
J013092F14                       5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013092F14

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+20609365-238
TSS clone peakAclone+20609497-106

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCTATAAAAC+2060933320609342-270-261
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGATGGGCT+2060909720609105-506-498
 OsREG456AGATGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG466 GATGGGCT PPDB MotifGCCCA  PLACE Motif 
REGTTCGGCCCATCT+2060925120609262-352-341
 OsREG642TTCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG658 TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590   GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG456    GCCCATCT PPDB MotifGCCCA  PLACE Motif 
REGCGCCACGT+2060932020609327-283-276
 OsREG448CGCCACGT PPDB MotifACGT  PLACE MotifACGTGKC 
REGCCGATCCGATCCGAC+2060942120609435-182-168
 OsREG541CCGATCCGATCCG   PPDB Motif  PLACE Motif 
 OsREG588       GATCCGAC PPDB MotifCCGAC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.