version
PlantPromoterDB promoter information of J013094L23

Summary of Gene (J013094L23)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0388500        NCBI 
Gene model J013094L23  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 18795980-18797179)

Genome position     
from initiation codon
AK065313            
AK098990            
AK104689            
J013002O22          
J065118O04          
TSS from cDNA
TSS information
J013094L23                       5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J013094L23

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+18796456-524
TSS clone peakCclone+18796462-518

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCCTCCCCTT+1879645018796460-530-520
Y PatchTCTCCTCCCCCCTCCCC+1879648218796498-498-482
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTTTGGGCCCAATCCGACG+1879621218796230-768-750
 OsREG592TTTTGGGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG639  TTGGGCCCAA        PPDB MotifGCCCA  PLACE Motif 
 OsREG492     GGCCCAAT       PPDB MotifGCCCA  PLACE Motif 
 OsREG483           ATCCGACG PPDB MotifCCGAC  PLACE MotifCGACG 
REGCTCCCCCA+1879625518796262-725-718
 OsREG574CTCCCCCA PPDB Motif  PLACE Motif 
REGCCCCCGCG+1879627018796277-710-703
 OsREG537CCCCCGCG PPDB Motif  PLACE Motif 
REGCGGCTCGG+1879629218796299-688-681
 OsREG540CGGCTCGG PPDB Motif  PLACE Motif 
REGAGCCCAAAT+1879631218796320-668-660
 OsREG457AGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG493 GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGCCCCCGCGACGCGCGAG+1879634018796356-640-624
 OsREG537CCCCCGCG          PPDB Motif  PLACE Motif 
 OsREG556    CGCGACGC      PPDB Motif  PLACE MotifCGACG 
 OsREG559     GCGACGCG     PPDB Motif  PLACE MotifCGACG 
 OsREG558         CGCGCGAG PPDB MotifACGCGC  PLACE Motif 
REGCCTCGCCC+1879639618796403-584-577
 OsREG549CCTCGCCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.